Login to display prices
Login to display prices
TMEM222-transmembrane protein 222 Gene View larger

TMEM222-transmembrane protein 222 Gene

PTXBC011579

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM222-transmembrane protein 222 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM222-transmembrane protein 222 Gene

Proteogenix catalog: PTXBC011579
Ncbi symbol: TMEM222
Product name: TMEM222-transmembrane protein 222 Gene
Size: 2ug
Accessions: BC011579
Gene id: 84065
Gene description: transmembrane protein 222
Synonyms: C1orf160; transmembrane protein 222
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaagtggaggcgccgacggcggccgagacggacatgaagcaatatcaaggctccggcggcgtcgccatggatgtggaacggagtcgcttcccctactgcgtggtgtggacgcccatcccggtgctcacgtggtttttccccatcatcggccacatgggcatctgcacatccacaggagtcattcgggacttcgcgggcccctactttgtctcagaggacaacatggcctttggaaagcctgccaagtactggaagttggaccctgctcaggtctatgctagcgggcccaacgcatgggacacggctgtgcacgacgcctctgaggagtacaagcaccgcatgcacaatctctgctgtgacaactgccactcgcacgtggcattggccctgaatctgatgcgctacaacaacagcaccaactggaatatggtgacgctctgcttcttctgcctgctctacgggaagtacgtcagcgttggggccttcgtgaagacctggctgcccttcatccttctcctgggcatcatcctcaccgtcagcctggtctttaacctccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: