Login to display prices
Login to display prices
TMEM186-transmembrane protein 186 Gene View larger

TMEM186-transmembrane protein 186 Gene

PTXBC015912

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM186-transmembrane protein 186 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM186-transmembrane protein 186 Gene

Proteogenix catalog: PTXBC015912
Ncbi symbol: TMEM186
Product name: TMEM186-transmembrane protein 186 Gene
Size: 2ug
Accessions: BC015912
Gene id: 25880
Gene description: transmembrane protein 186
Synonyms: C16orf51; transmembrane protein 186
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcccttctccgagctgtgcgtaggtttcggggaaaagctgtgtgggaaaggcctctccatgggctgtggtgctgcagtgggcaggaggatcctaagaggtgggtgggcagcagttcacccatctcgaaggagaaactaccaaacgcagagactgagaaattctggatgttttaccgttttgatgccatcagaaccttcgggttcctgtcacgactgaagttggcacagactgccctgacagtggtagctttgccaccaggctattacttgtactcccagggcctcctcactctcaacaccgtgtgcctcatgagtgggatatcgggctttgccctgaccatgctgtgctggatgagctatttcttacggagactggttggtatcctgtatctgaatgagtctggcaccatgctgcgggtggcccatctgaacttctggggctggcggcaggacacatactgtcccatggcagatgtgattcccctgacagaaaccaaggaccggcctcaggagatgtttgtgcgtatccagcggtacagtgggaaacagaccttctacgtcaccctgcgctatggacgcatcctggacagagagcgtttcacacaggtgtttggggtacatcagatgctcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice