Login to display prices
Login to display prices
KLHL20-kelch-like 20 (Drosophila) Gene View larger

KLHL20-kelch-like 20 (Drosophila) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLHL20-kelch-like 20 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KLHL20-kelch-like 20 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005253
Product type: DNA & cDNA
Ncbi symbol: KLHL20
Origin species: Human
Product name: KLHL20-kelch-like 20 (Drosophila) Gene
Size: 2ug
Accessions: BC005253
Gene id: 27252
Gene description: kelch-like 20 (Drosophila)
Synonyms: KHLHX; KLEIP; KLHLX; kelch-like protein 20; Kelch motif containing protein; kelch-like ECT2-interacting protein; kelch-like protein X; kelch like family member 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggaaagccaatgcgcaggtgtaccaacattcgaccaggagagactggaatggatgtaacaagccgctgcacccttggagaccccaacaaactgccagaaggggttccccaacctgcccgcatgccctatatctcagacaagcaccctcgacaaaccttggaagtgattaaccttctgagaaagcaccgggagctatgtgatgtggtgctagttgtgggcgccaagaagatatatgcccatcgagtcattttgtcagcctgtagtccctacttccgagctatgtttacaggagaattggcagagagccgtcagacagaagtagtgatccgagacattgacgagagggctatggaattactgattgactttgcgtatacctcccagataacagtagaagagggcaatgttcagactcttctgccagctgcttgcctcctccagctggcagaaatacaggaagcctgctgtgaattcttaaagagacaattagatccttctaactgcctgggcattcgggcttttgctgacacacattcatgtcgtgagttgctaaggatagcagacaagttcacccaacataactttcaagaggtgagttgcacttggtgttccaatgcacccatttgttggagagcaatatgggttcacattctgctaaataacacttgcctgggtatttcctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyltransferase like 2A
- kelch-like 14 (Drosophila)
- THUMP domain containing 2
- PWP1 homolog (S. cerevisiae)