METTL2A-methyltransferase like 2A Gene View larger

METTL2A-methyltransferase like 2A Gene

PTXBC006985

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of METTL2A-methyltransferase like 2A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about METTL2A-methyltransferase like 2A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006985
Product type: DNA & cDNA
Ncbi symbol: METTL2A
Origin species: Human
Product name: METTL2A-methyltransferase like 2A Gene
Size: 2ug
Accessions: BC006985
Gene id: 339175
Gene description: methyltransferase like 2A
Synonyms: METTL2; methyltransferase-like protein 2A; methyltransferase like 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagaacagcacaagtgttcttcgaagagccttgaacataaaacacagacacctcctgtggaggagaatgtaactcagaaaattagtgacctggaaatttgtgctgatgagtttcctggatcctcagccacctaccgaatactggaggttggctgtggtgtgggaaacacagtctttccaattttacaaacgaacaatgacccaggactctttgtttattgctgtgatttttcttccacagctatagaactggtccagacaaattcagaatatgatccttctcggtgttttgcctttgttcacgacctgtgtgatgaagagaagagttacccagtgcccaagggcagtcttgatattatcattctcatatttgttctttcagcaattgttccagacaagatgcagaaggctatcaacaggctgagcaggcttctgaaacctggcgggatgatgcttctgcgagattacggccgctatgacatggctcagcttcggtttaaaaaaggtcagtgtctatctggaaatttctacgtgagaggtgatggaaccagagtttacttcttcacacaagaggaactggacacgcttttcaccactgctggactggaaaaagttcagaacctggtggatcgccgactgcaggtgaaccgaggaaagcaactgacaatgtaccgggtttggattcagtgcaaatactgcaagccccttctgtccagcaccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch-like 14 (Drosophila)
- THUMP domain containing 2
- PWP1 homolog (S. cerevisiae)
- death inducer-obliterator 1

Buy METTL2A-methyltransferase like 2A Gene now

Add to cart