DKFZp761E198-DKFZp761E198 protein Gene View larger

DKFZp761E198-DKFZp761E198 protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DKFZp761E198-DKFZp761E198 protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DKFZp761E198-DKFZp761E198 protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017264
Product type: DNA & cDNA
Ncbi symbol: DKFZp761E198
Origin species: Human
Product name: DKFZp761E198-DKFZp761E198 protein Gene
Size: 2ug
Accessions: BC017264
Gene id: 91056
Gene description: DKFZp761E198 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgcaggaggcaccggccctggtacggctgagcctggggtcccatcgggtcaagggcccactcccagtgttgaagctccagccggaggcgctggagcccatctactctctggagctgcgcttccgtgtggaaggacagctgtatgcacccctggaggctgtccatgtgccctgcctgtgtcctggccgccctgcccgccctctgctcctgcctctgcagccccgatgcccggcccccgcacggctggatgtccatgccctttacaccacatccactggtctcacgtgccatgcccacttgccacccctgttcgtgaactttgccgacctctttctgcctttcccgcagcctccagagggggccgggctgggcttctttgaggagctctgggattcctgcctgccagagggtgctgagagtcgtgtgtggtgtccacttgggccacagggcctggagggcttggtgtcccgccacctggagccttttgtggtggtggcccagcctcctaccagctactgtgtagcaatccacctgcccccggactcaaagctgctgctgcggctggaggcggccctggcagatggagtgcctgtggccctgcggaccgatgactgggccgtgctgcccctggcgggggactacctccgtgggctggcggctgctgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch-like 20 (Drosophila)
- methyltransferase like 2A
- kelch-like 14 (Drosophila)
- THUMP domain containing 2

Buy DKFZp761E198-DKFZp761E198 protein Gene now

Add to cart