MED28-mediator complex subunit 28 Gene View larger

MED28-mediator complex subunit 28 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MED28-mediator complex subunit 28 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MED28-mediator complex subunit 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011936
Product type: DNA & cDNA
Ncbi symbol: MED28
Origin species: Human
Product name: MED28-mediator complex subunit 28 Gene
Size: 2ug
Accessions: BC011936
Gene id: 80306
Gene description: mediator complex subunit 28
Synonyms: 1500003D12Rik; EG1; magicin; mediator of RNA polymerase II transcription subunit 28; endothelial-derived gene 1; endothelial-derived protein 1; mediator of RNA polymerase II transcription, subunit 28 homolog; merlin and Grb2-interacting cytoskeletal protein; tumor angiogenesis marker EG-1; mediator complex subunit 28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctccactagggggtatgttttctgggcagccacccggtccccctcaggccccgccgggccttccgggccaagcttcgcttcttcaggcagctccaggcgctcctagaccttccagcagtactttggtggacgagttggagtcatctttcgaggcttgctttgcatctctggtgagtcaggactatgtcaatggcaccgatcaggaagaaattcgaaccggtgttgatcagtgtatccagaagtttctggatattgcaagacagacagaatgttttttcttacaaaaaagattgcagttatctgtccagaaaccagagcaagttatcaaagaggatgtgtcagaactaaggaatgaattacagcggaaagatgcactagtccagaagcacttgacaaagctgaggcattggcagcaggtgctggaggacatcaacgtgcagcacaaaaagcccgccgacatccctcagggctccttggcctacctggagcaggcatctgccaacatccctgcacctctgaagccaacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 222
- SERTA domain containing 3
- transmembrane protein 186
- ribosomal protein L10-like

Buy MED28-mediator complex subunit 28 Gene now

Add to cart