Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MED28-mediator complex subunit 28 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MED28-mediator complex subunit 28 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011936 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MED28 |
| Origin species: | Human |
| Product name: | MED28-mediator complex subunit 28 Gene |
| Size: | 2ug |
| Accessions: | BC011936 |
| Gene id: | 80306 |
| Gene description: | mediator complex subunit 28 |
| Synonyms: | 1500003D12Rik; EG1; magicin; mediator of RNA polymerase II transcription subunit 28; endothelial-derived gene 1; endothelial-derived protein 1; mediator of RNA polymerase II transcription, subunit 28 homolog; merlin and Grb2-interacting cytoskeletal protein; tumor angiogenesis marker EG-1; mediator complex subunit 28 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctccactagggggtatgttttctgggcagccacccggtccccctcaggccccgccgggccttccgggccaagcttcgcttcttcaggcagctccaggcgctcctagaccttccagcagtactttggtggacgagttggagtcatctttcgaggcttgctttgcatctctggtgagtcaggactatgtcaatggcaccgatcaggaagaaattcgaaccggtgttgatcagtgtatccagaagtttctggatattgcaagacagacagaatgttttttcttacaaaaaagattgcagttatctgtccagaaaccagagcaagttatcaaagaggatgtgtcagaactaaggaatgaattacagcggaaagatgcactagtccagaagcacttgacaaagctgaggcattggcagcaggtgctggaggacatcaacgtgcagcacaaaaagcccgccgacatccctcagggctccttggcctacctggagcaggcatctgccaacatccctgcacctctgaagccaacgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 222 - SERTA domain containing 3 - transmembrane protein 186 - ribosomal protein L10-like |