Login to display prices
Login to display prices
TMEM100-transmembrane protein 100 Gene View larger

TMEM100-transmembrane protein 100 Gene

PTXBC010128

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM100-transmembrane protein 100 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM100-transmembrane protein 100 Gene

Proteogenix catalog: PTXBC010128
Ncbi symbol: TMEM100
Product name: TMEM100-transmembrane protein 100 Gene
Size: 2ug
Accessions: BC010128
Gene id: 55273
Gene description: transmembrane protein 100
Synonyms: transmembrane protein 100
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgaagagcccatcaaggagatcctgggagccccaaaggctcacatggcagcgacgatggagaagagccccaagagtgaagttgtgatcaccacagtccctctggtcagtgagattcagttgatggctgctacagggggtaccgagctctcctgctaccgctgcatcatcccctttgctgtggttgtcttcatcgccggcatcgtggtcaccgcggtggcttacagcttcaattcccatgggtctattatctccatctttggcctggttgttctgtcatctggactttttttactagcctccagtgccttgtgctggaaagtgagacaaaggagcaagaaagccaagagacgggagagtcaaacagctctcgtggcaaatcagagaagcttgtttgcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: