TMEM100-transmembrane protein 100 Gene View larger

TMEM100-transmembrane protein 100 Gene

PTXBC010128

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM100-transmembrane protein 100 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM100-transmembrane protein 100 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010128
Product type: DNA & cDNA
Ncbi symbol: TMEM100
Origin species: Human
Product name: TMEM100-transmembrane protein 100 Gene
Size: 2ug
Accessions: BC010128
Gene id: 55273
Gene description: transmembrane protein 100
Synonyms: transmembrane protein 100
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgaagagcccatcaaggagatcctgggagccccaaaggctcacatggcagcgacgatggagaagagccccaagagtgaagttgtgatcaccacagtccctctggtcagtgagattcagttgatggctgctacagggggtaccgagctctcctgctaccgctgcatcatcccctttgctgtggttgtcttcatcgccggcatcgtggtcaccgcggtggcttacagcttcaattcccatgggtctattatctccatctttggcctggttgttctgtcatctggactttttttactagcctccagtgccttgtgctggaaagtgagacaaaggagcaagaaagccaagagacgggagagtcaaacagctctcgtggcaaatcagagaagcttgtttgcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 203
- enabled homolog (Drosophila)
- translocator protein (18kDa)
- transmembrane protein 208

Buy TMEM100-transmembrane protein 100 Gene now

Add to cart