Login to display prices
Login to display prices
TMEM203-transmembrane protein 203 Gene View larger

TMEM203-transmembrane protein 203 Gene

PTXBC009283

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM203-transmembrane protein 203 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM203-transmembrane protein 203 Gene

Proteogenix catalog: PTXBC009283
Ncbi symbol: TMEM203
Product name: TMEM203-transmembrane protein 203 Gene
Size: 2ug
Accessions: BC009283
Gene id: 94107
Gene description: transmembrane protein 203
Synonyms: HBEBP1; transmembrane protein 203; HBeAg-binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcttctcgctccgggagctggtgcagtggctaggcttcgccaccttcgagatcttcgtgcacctgctggccctgttggtgttctctgtgctgctggcactgcgtgtggatggcctggtcccgggcctctcctggtggaacgtgttcgtgcctttcttcgccgctgacgggctcagcacctacttcaccaccatcgtgtccgtgcgcctcttccaggatggagagaagcggctggcggtgctccgccttttctgggtacttacggtcctgagtctcaagttcgtcttcgagatgctgttgtgccagaagctggcggagcagactcgggagctctggttcggcctcattacgtccccgctcttcattctcctgcagctgctcatgatccgcgcctgtcgggtcaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: