FXYD6-FXYD domain containing ion transport regulator 6 Gene View larger

FXYD6-FXYD domain containing ion transport regulator 6 Gene

PTXBC018652

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FXYD6-FXYD domain containing ion transport regulator 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FXYD6-FXYD domain containing ion transport regulator 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018652
Product type: DNA & cDNA
Ncbi symbol: FXYD6
Origin species: Human
Product name: FXYD6-FXYD domain containing ion transport regulator 6 Gene
Size: 2ug
Accessions: BC018652
Gene id: 53826
Gene description: FXYD domain containing ion transport regulator 6
Synonyms: FXYD domain-containing ion transport regulator 6; phosphohippolin; FXYD domain containing ion transport regulator 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttggtgctggtcttcctctgcagcctgctggcccccatggtcctggccagtgcagctgaaaaggagaaggaaatggacccttttcattatgattaccagaccctgaggattgggggactggtgttcgctgtggtcctcttctcggttgggatcctccttatcctaagtcgcaggtgcaagtgcagtttcaatcagaagccccgggccccaggagatgaggaagcccaggtggagaacctcatcaccgccaatgcaacagagccccagaaagcagagaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - P antigen family, member 4 (prostate associated)
- ubiquinol-cytochrome c reductase binding protein
- leucine zipper, down-regulated in cancer 1-like
- P antigen family, member 5 (prostate associated)

Buy FXYD6-FXYD domain containing ion transport regulator 6 Gene now

Add to cart