Login to display prices
Login to display prices
FXYD6-FXYD domain containing ion transport regulator 6 Gene View larger

FXYD6-FXYD domain containing ion transport regulator 6 Gene

PTXBC018652

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FXYD6-FXYD domain containing ion transport regulator 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FXYD6-FXYD domain containing ion transport regulator 6 Gene

Proteogenix catalog: PTXBC018652
Ncbi symbol: FXYD6
Product name: FXYD6-FXYD domain containing ion transport regulator 6 Gene
Size: 2ug
Accessions: BC018652
Gene id: 53826
Gene description: FXYD domain containing ion transport regulator 6
Synonyms: FXYD domain-containing ion transport regulator 6; phosphohippolin; FXYD domain containing ion transport regulator 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttggtgctggtcttcctctgcagcctgctggcccccatggtcctggccagtgcagctgaaaaggagaaggaaatggacccttttcattatgattaccagaccctgaggattgggggactggtgttcgctgtggtcctcttctcggttgggatcctccttatcctaagtcgcaggtgcaagtgcagtttcaatcagaagccccgggccccaggagatgaggaagcccaggtggagaacctcatcaccgccaatgcaacagagccccagaaagcagagaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: