Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PAGE4-P antigen family, member 4 (prostate associated) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAGE4-P antigen family, member 4 (prostate associated) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010897 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAGE4 |
| Origin species: | Human |
| Product name: | PAGE4-P antigen family, member 4 (prostate associated) Gene |
| Size: | 2ug |
| Accessions: | BC010897 |
| Gene id: | 9506 |
| Gene description: | P antigen family, member 4 (prostate associated) |
| Synonyms: | CT16.7; GAGE-9; GAGEC1; JM-27; JM27; PAGE-1; PAGE-4; P antigen family member 4; P antigen family, member 4 (prostate associated); g antigen family C member 1; prostate-associated gene protein 4; PAGE family member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgcacgagtgagatcaagatccagaggaagaggagatggtcaggaggctcccgatgtggttgcattcgtggctcccggtgaatctcagcaagaggaaccaccaactgacaatcaggatattgaacctggacaagagagagaaggaacacctccgatcgaagaacgtaaagtagaaggtgattgccaggaaatggatctggaaaagactcggagtgagcgtggagatggctctgatgtaaaagagaagactccacctaatcctaagcatgctaagactaaagaagcaggagatgggcagccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquinol-cytochrome c reductase binding protein - leucine zipper, down-regulated in cancer 1-like - P antigen family, member 5 (prostate associated) - protein tyrosine phosphatase type IVA, member 3 |