Login to display prices
Login to display prices
UQCRB-ubiquinol-cytochrome c reductase binding protein Gene View larger

UQCRB-ubiquinol-cytochrome c reductase binding protein Gene

PTXBC005230

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UQCRB-ubiquinol-cytochrome c reductase binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UQCRB-ubiquinol-cytochrome c reductase binding protein Gene

Proteogenix catalog: PTXBC005230
Ncbi symbol: UQCRB
Product name: UQCRB-ubiquinol-cytochrome c reductase binding protein Gene
Size: 2ug
Accessions: BC005230
Gene id: 7381
Gene description: ubiquinol-cytochrome c reductase binding protein
Synonyms: MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC; cytochrome b-c1 complex subunit 7; complex III subunit 7; complex III subunit VII; mitochondrial ubiquinone-binding protein; ubiquinol-cytochrome c reductase complex 14 kDa protein; ubiquinol-cytochrome c reductase, complex III subunit VI; ubiquinol-cytochrome c reductase binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggtaagcaggccgtttcagcatcaggcaagtggctggatggtattcgaaaatggtattacaatgctgcaggattcaataaactggggttaatgcgagatgatacaatatacgaggatgaagatgtaaaagaagccataagaagacttcctgagaacctttataatgacaggatgtttcgcattaagagggcactggacctgaacttgaagcatcagatcttgcctaaagagcagtggaccaaatatgaagaggaaaatttctaccttgaaccgtatctgaaagaggttattcgggaaagaaaagaaagagaagaatgggcaaagaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: