Login to display prices
Login to display prices
PAGE5-P antigen family, member 5 (prostate associated) Gene View larger

PAGE5-P antigen family, member 5 (prostate associated) Gene

PTXBC009230

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAGE5-P antigen family, member 5 (prostate associated) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAGE5-P antigen family, member 5 (prostate associated) Gene

Proteogenix catalog: PTXBC009230
Ncbi symbol: PAGE5
Product name: PAGE5-P antigen family, member 5 (prostate associated) Gene
Size: 2ug
Accessions: BC009230
Gene id: 90737
Gene description: P antigen family, member 5 (prostate associated)
Synonyms: CT16; CT16.1; CT16.2; GAGEE1; PAGE-5; P antigen family member 5; P antigen family, member 5 (prostate associated); cancer/testis antigen 16.1; cancer/testis antigen family 16, member 1; cancer/testis antigen family 16, member 2; g antigen family E member 1; prostate-associated gene 5 protein; PAGE family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggcgccatgggccggtaatcgtggctgggctggaacgagggaggaagtgagagatatgagtgagcatgtaacaagatcccaatcctcagaaagaggaaatgaccaagagtcttcccagccagttggacctgtgattgtccagcagcccactgaggaaaaacgtcaagaagaggaaccaccaactgataatcagggtattgcacctagtggggagatcaaaaatgaaggagcacctgctgttcaagggactgatgtggaagcttttcaacaggaactggctctgcttaagatagaggatgcacctggagatggtcctgatgtcagggaggggactctgcccacttttgatcccactaaagtgctggaagcaggtgaagggcaactatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: