PAGE5-P antigen family, member 5 (prostate associated) Gene View larger

PAGE5-P antigen family, member 5 (prostate associated) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAGE5-P antigen family, member 5 (prostate associated) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PAGE5-P antigen family, member 5 (prostate associated) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009230
Product type: DNA & cDNA
Ncbi symbol: PAGE5
Origin species: Human
Product name: PAGE5-P antigen family, member 5 (prostate associated) Gene
Size: 2ug
Accessions: BC009230
Gene id: 90737
Gene description: P antigen family, member 5 (prostate associated)
Synonyms: CT16; CT16.1; CT16.2; GAGEE1; PAGE-5; P antigen family member 5; P antigen family, member 5 (prostate associated); cancer/testis antigen 16.1; cancer/testis antigen family 16, member 1; cancer/testis antigen family 16, member 2; g antigen family E member 1; prostate-associated gene 5 protein; PAGE family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggcgccatgggccggtaatcgtggctgggctggaacgagggaggaagtgagagatatgagtgagcatgtaacaagatcccaatcctcagaaagaggaaatgaccaagagtcttcccagccagttggacctgtgattgtccagcagcccactgaggaaaaacgtcaagaagaggaaccaccaactgataatcagggtattgcacctagtggggagatcaaaaatgaaggagcacctgctgttcaagggactgatgtggaagcttttcaacaggaactggctctgcttaagatagaggatgcacctggagatggtcctgatgtcagggaggggactctgcccacttttgatcccactaaagtgctggaagcaggtgaagggcaactatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein tyrosine phosphatase type IVA, member 3
- acyl-CoA synthetase medium-chain family member 5
- CDC42 effector protein (Rho GTPase binding) 3
- ATPase, Na+/K+ transporting, beta 1 polypeptide

Buy PAGE5-P antigen family, member 5 (prostate associated) Gene now

Add to cart