Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LDOC1L-leucine zipper, down-regulated in cancer 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LDOC1L-leucine zipper, down-regulated in cancer 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018713 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LDOC1L |
| Origin species: | Human |
| Product name: | LDOC1L-leucine zipper, down-regulated in cancer 1-like Gene |
| Size: | 2ug |
| Accessions: | BC018713 |
| Gene id: | 84247 |
| Gene description: | leucine zipper, down-regulated in cancer 1-like |
| Synonyms: | protein LDOC1L; Mar6; Mart6; dJ1033E15.2; leucine zipper protein down-regulated in cancer cells-like; mammalian retrotransposon-derived protein 6; leucine zipper down-regulated in cancer 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgctctttaagcgtgatcggagggaagacacacagcagggccaccattccatgaatgggaggtgtacagatcactttctctttgtgctcagttctgttctgtctccagcagctatattggtaagactagtacctgccagggagaggtgcccccaagtgaaggggtacagtggcacctgggaaaaggcacctggaaggtttccatgtggcccagcccagcatggaagcagggtgggaactctgctgtgtcgccagcgctcactctactcgagtggctttttgaaagccctaccatgtctgtgtcaggcctgtgctgcttcacatcctacagctgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - P antigen family, member 5 (prostate associated) - protein tyrosine phosphatase type IVA, member 3 - acyl-CoA synthetase medium-chain family member 5 - CDC42 effector protein (Rho GTPase binding) 3 |