PTXBC001792
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001792 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMUB2 |
| Origin species: | Human |
| Product name: | TMUB2-transmembrane and ubiquitin-like domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC001792 |
| Gene id: | 79089 |
| Gene description: | transmembrane and ubiquitin-like domain containing 2 |
| Synonyms: | FP2653; transmembrane and ubiquitin-like domain-containing protein 2; transmembrane and ubiquitin like domain containing 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctctctgatgtcaccctcattgagggtgtgggtaatgaggtgatggtggtggcaggtgtggtggtgctgattctagccttggtcctagcttggctctctacctacgtagcagacagcggtagcaaccagctcctgggcgctattgtgtcagcaggcgacacatccgtcctccacctggggcatgtggaccacctggtggcaggccaaggcaaccccgagccaactgaactcccccatccatcagaggcaaatacttccctggacaagaaagccagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - pleckstrin homology-like domain, family B, member 1 - staufen, RNA binding protein, homolog 2 (Drosophila) - SH3 domain binding glutamic acid-rich protein like - ChaC, cation transport regulator homolog 2 (E. coli) |