S100A1-S100 calcium binding protein A1 Gene View larger

S100A1-S100 calcium binding protein A1 Gene

PTXBC014392

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A1-S100 calcium binding protein A1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A1-S100 calcium binding protein A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014392
Product type: DNA & cDNA
Ncbi symbol: S100A1
Origin species: Human
Product name: S100A1-S100 calcium binding protein A1 Gene
Size: 2ug
Accessions: BC014392
Gene id: 6271
Gene description: S100 calcium binding protein A1
Synonyms: S100-alpha; S100A; protein S100-A1; S-100 protein alpha chain; S-100 protein subunit alpha; S100 alpha; S100 protein, alpha polypeptide; S100 calcium binding protein A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctctgagctggagacggcgatggagaccctcatcaacgtgttccacgcccactcgggcaaagagggggacaagtacaagctgagcaagaaggagctgaaagagctgctgcagacggagctctctggcttcctggatgcccagaaggatgtggatgctgtggacaaggtgatgaaggagctagacgagaatggagacggggaggtggacttccaggagtatgtggtgcttgtggctgctctcacagtggcctgtaacaatttcttctgggagaacagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S100 calcium binding protein A4
- endothelial PAS domain protein 1
- chemokine (C-X-C motif) ligand 3
- hypothetical protein MGC16291

Buy S100A1-S100 calcium binding protein A1 Gene now

Add to cart