Login to display prices
Login to display prices
C1orf97-chromosome 1 open reading frame 97 Gene View larger

C1orf97-chromosome 1 open reading frame 97 Gene

PTXBC005997

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C1orf97-chromosome 1 open reading frame 97 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C1orf97-chromosome 1 open reading frame 97 Gene

Proteogenix catalog: PTXBC005997
Ncbi symbol: C1orf97
Product name: C1orf97-chromosome 1 open reading frame 97 Gene
Size: 2ug
Accessions: BC005997
Gene id: 84791
Gene description: chromosome 1 open reading frame 97
Synonyms: C1orf97; RP11-318L16.3; long intergenic non-protein coding RNA 467
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggataagaagtccactcacagaaatcctgaagatgccagggctggcaaatatgaaggtaaacacaaacgaaagaaaagaagaaagcaaaaccaaaaccagcaccgatcccgacatagatcagtgacgtctttttcttcagatgatcctatgtttccttcttcctcatcatcgtcttcaggaagccagacagattcaagtattgaagatgctgccaagggaaaaattaagaagaagagaagagagaaaacaaataaatgggaaaaaagaaaggacaaaatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: