Login to display prices
Login to display prices
C9orf116-chromosome 9 open reading frame 116 Gene View larger

C9orf116-chromosome 9 open reading frame 116 Gene

PTXBC021261

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf116-chromosome 9 open reading frame 116 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf116-chromosome 9 open reading frame 116 Gene

Proteogenix catalog: PTXBC021261
Ncbi symbol: C9orf116
Product name: C9orf116-chromosome 9 open reading frame 116 Gene
Size: 2ug
Accessions: BC021261
Gene id: 138162
Gene description: chromosome 9 open reading frame 116
Synonyms: UPF0691 protein C9orf116; PIERCE1; RbEST47; p53-induced expression 1 in Rb−/− cells; p53-induced expression in RB-null cells protein 1; pierce 1; chromosome 9 open reading frame 116
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaggaatgccccagagcgtgcgcggagcctgtggcgcccaaggccacggccccgccggagaggaccagcgactactaccgcgtgagcgcggacctgccgggcaggttcaacaacccggggtggttccggggctacaggacccagaaggctgtctccgtgtacaggaccagtaaccaggcttacgggagcagagcccccaccgtgcacgagatgcctcgggtggaatgttccggaacaatactctcaatgtttacctggagaaaagcatcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: