C9orf116-chromosome 9 open reading frame 116 Gene View larger

C9orf116-chromosome 9 open reading frame 116 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf116-chromosome 9 open reading frame 116 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf116-chromosome 9 open reading frame 116 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021261
Product type: DNA & cDNA
Ncbi symbol: C9orf116
Origin species: Human
Product name: C9orf116-chromosome 9 open reading frame 116 Gene
Size: 2ug
Accessions: BC021261
Gene id: 138162
Gene description: chromosome 9 open reading frame 116
Synonyms: UPF0691 protein C9orf116; PIERCE1; RbEST47; p53-induced expression 1 in Rb−/− cells; p53-induced expression in RB-null cells protein 1; pierce 1; chromosome 9 open reading frame 116
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaggaatgccccagagcgtgcgcggagcctgtggcgcccaaggccacggccccgccggagaggaccagcgactactaccgcgtgagcgcggacctgccgggcaggttcaacaacccggggtggttccggggctacaggacccagaaggctgtctccgtgtacaggaccagtaaccaggcttacgggagcagagcccccaccgtgcacgagatgcctcgggtggaatgttccggaacaatactctcaatgtttacctggagaaaagcatcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 32
- chromosome 17 open reading frame 37
- glycoprotein hormones, alpha polypeptide
- chromosome 20 open reading frame 30

Buy C9orf116-chromosome 9 open reading frame 116 Gene now

Add to cart