C20orf24-chromosome 20 open reading frame 24 Gene View larger

C20orf24-chromosome 20 open reading frame 24 Gene

PTXBC004446

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C20orf24-chromosome 20 open reading frame 24 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C20orf24-chromosome 20 open reading frame 24 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004446
Product type: DNA & cDNA
Ncbi symbol: C20orf24
Origin species: Human
Product name: C20orf24-chromosome 20 open reading frame 24 Gene
Size: 2ug
Accessions: BC004446
Gene id: 55969
Gene description: chromosome 20 open reading frame 24
Synonyms: uncharacterized protein C20orf24; PNAS-11; RIP5; rab5-interacting protein; chromosome 20 open reading frame 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcggcgggcggcggaaggaggagccgcctcagccgcagctggccaacggggccctcaaagtctccgtctggagtaaggtgctgcggagcgacgcggcctgggaggataaggatgaatttttagatgtgatctactggttccgacagatcattgctgtggtcctgggtgtcatttggggagttttgccattacgagggttcttgggaatagcagggaaaggccattgctgctctggagctgtgtgtgtgtgtgatgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 116
- chromosome 10 open reading frame 32
- chromosome 17 open reading frame 37
- glycoprotein hormones, alpha polypeptide

Buy C20orf24-chromosome 20 open reading frame 24 Gene now

Add to cart