Login to display prices
Login to display prices
C6orf115-chromosome 6 open reading frame 115 Gene View larger

C6orf115-chromosome 6 open reading frame 115 Gene

PTXBC014953

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf115-chromosome 6 open reading frame 115 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf115-chromosome 6 open reading frame 115 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014953
Product type: DNA & cDNA
Ncbi symbol: C6orf115
Origin species: Human
Product name: C6orf115-chromosome 6 open reading frame 115 Gene
Size: 2ug
Accessions: BC014953
Gene id: 58527
Gene description: chromosome 6 open reading frame 115
Synonyms: C6orf115; Costars; HSPC280; PRO2013; costars family protein ABRACL; ABRA C-terminal-like protein; ABRA C-terminal like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgtggatcacgaggttaacctcttagtggaggaaattcatcgtttgggttcaaaaaatgctgatggaaagttaagcgtgaaatttggggtcctcttccgtgatgataaatgtgccaacctctttgaagcattggtaggaactcttaaagctgcaaaacgaaggaagattgtaacatatccaggagagctgcttctgcaaggtgttcatgatgatgttgacattatattactgcaagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 20 open reading frame 24
- chromosome 9 open reading frame 116
- chromosome 10 open reading frame 32
- chromosome 17 open reading frame 37