Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of LZIC-leucine zipper and CTNNBIP1 domain containing Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LZIC-leucine zipper and CTNNBIP1 domain containing Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007240 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LZIC |
| Origin species: | Human |
| Product name: | LZIC-leucine zipper and CTNNBIP1 domain containing Gene |
| Size: | 2ug |
| Accessions: | BC007240 |
| Gene id: | 84328 |
| Gene description: | leucine zipper and CTNNBIP1 domain containing |
| Synonyms: | protein LZIC; leucine zipper and CTNNBIP1 domain-containing protein; leucine zipper and ICAT homologous domain-containing protein; leucine zipper domain and ICAT homologous domain containing; leucine zipper and CTNNBIP1 domain containing |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatagagatctgatggtaggaaagctggaaagagacctgtacactcaacagaaagtggagatactaacagctcttaggaaacttggagagaagctgactgcagatgatgaggccttcttgtcagcaaatgcaggtgctatactcagccagtttgagaaagtctctacagaccttggctctggagacaaaattcttgctctggcaagttttgaggttgaaaaaacaaaaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cerebral endothelial cell adhesion molecule - deoxythymidylate kinase (thymidylate kinase) - hydroxysteroid (17-beta) dehydrogenase 10 - secretagogin, EF-hand calcium binding protein |