Login to display prices
Login to display prices
LZIC-leucine zipper and CTNNBIP1 domain containing Gene View larger

LZIC-leucine zipper and CTNNBIP1 domain containing Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LZIC-leucine zipper and CTNNBIP1 domain containing Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LZIC-leucine zipper and CTNNBIP1 domain containing Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007240
Product type: DNA & cDNA
Ncbi symbol: LZIC
Origin species: Human
Product name: LZIC-leucine zipper and CTNNBIP1 domain containing Gene
Size: 2ug
Accessions: BC007240
Gene id: 84328
Gene description: leucine zipper and CTNNBIP1 domain containing
Synonyms: protein LZIC; leucine zipper and CTNNBIP1 domain-containing protein; leucine zipper and ICAT homologous domain-containing protein; leucine zipper domain and ICAT homologous domain containing; leucine zipper and CTNNBIP1 domain containing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatagagatctgatggtaggaaagctggaaagagacctgtacactcaacagaaagtggagatactaacagctcttaggaaacttggagagaagctgactgcagatgatgaggccttcttgtcagcaaatgcaggtgctatactcagccagtttgagaaagtctctacagaccttggctctggagacaaaattcttgctctggcaagttttgaggttgaaaaaacaaaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cerebral endothelial cell adhesion molecule
- deoxythymidylate kinase (thymidylate kinase)
- hydroxysteroid (17-beta) dehydrogenase 10
- secretagogin, EF-hand calcium binding protein