Login to display prices
Login to display prices
HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene View larger

HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene

PTXBC008708

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene

Proteogenix catalog: PTXBC008708
Ncbi symbol: HSD17B10
Product name: HSD17B10-hydroxysteroid (17-beta) dehydrogenase 10 Gene
Size: 2ug
Accessions: BC008708
Gene id: 3028
Gene description: hydroxysteroid (17-beta) dehydrogenase 10
Synonyms: 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1; 3-hydroxyacyl-CoA dehydrogenase type-2; 3-hydroxy-2-methylbutyryl-CoA dehydrogenase; AB-binding alcohol dehydrogenase; amyloid-beta peptide binding alcohol dehydrogenase; endoplasmic reticulum-associated amyloid beta-peptide-binding protein; mitochondrial RNase P subunit 2; mitochondrial ribonuclease P protein 2; short chain L-3-hydroxyacyl-CoA dehydrogenase type 2; short chain type dehydrogenase/reductase XH98G2; hydroxysteroid 17-beta dehydrogenase 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcagcgtgtcggagcgtgaagggcctggtggcggtaataaccggaggagcctcgggcctgggcctggccacggcggagcgacttgtggggcagggagcctctgctgtgcttctggacctgcccaactcgggtggggaggcccaagccaagaagttaggaaacaactgcgttttcgccccagccgacgtgacctctgagaaggatgtgcaaacagctctggctctagcaaaaggaaagtttggccgtgtggatgtagctgtcaactgtgcaggcatcgcggtggctagcaagacgtacaacttaaagaagggccagacccataccttggaagacttccagcgagttcttgatgtgaatctcatgggcaccttcaatgtgatccgcctggtggctggtgagatgggccagaatgaaccagaccagggaggccaacgtggggtcatcatcaacactgccagtgtggctgccttcgagggtcaggttggacaagctgcatactctgcttccaaggggggaatagtgggcatgacactgcccattgctcgggatctggctcccataggtctgtttggcaccccactgctgaccagcctcccagagaaagtgtgcaacttcttggccagccaagtgcccttccctagccgactgggtgaccctgctgagtatgctcacctcgtacaggccatcatcgagaacccattcctcaatggagaggtcatccggctggatggggccattcgtatgcagccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: