SCGN-secretagogin, EF-hand calcium binding protein Gene View larger

SCGN-secretagogin, EF-hand calcium binding protein Gene

PTXBC000336

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCGN-secretagogin, EF-hand calcium binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCGN-secretagogin, EF-hand calcium binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000336
Product type: DNA & cDNA
Ncbi symbol: SCGN
Origin species: Human
Product name: SCGN-secretagogin, EF-hand calcium binding protein Gene
Size: 2ug
Accessions: BC000336
Gene id: 10590
Gene description: secretagogin, EF-hand calcium binding protein
Synonyms: CALBL; DJ501N12.8; SECRET; SEGN; setagin; secretagogin, EF-hand calcium binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacagctcccgggaaccgactctggggcgcttggacgccgctggcttctggcaggtctggcagcgctttgatgcggatgaaaaaggttacatagaagagaaggaactcgatgctttctttctccacatgttgatgaaactgggtactgatgacacggtcatgaaagcaaatttgcacaaggtgaaacagcagtttatgactacccaagatgcctctaaagatggtcgcattcggatgaaagagcttgctggtatgttcttatctgaggatgaaaactttcttctgctctttcgccgggaaaacccactggacagcagcgtggagtttatgcagatttggcgcaaatatgacgctgacagcagtggctttatatcagctgctgagctccgcaacttcctccgagacctctttcttcaccacaaaaaggccatttctgaggctaaactggaagaatacactggcaccatgatgaagatttttgacagaaataaagatggtcggttggatctaaatgacttagcaaggattctggctcttcaggaaaacttccttctccaatttaaaatggatgcttgttctactgaagaaaggaaaagggactttgagaaaatctttgcctactatgatgttagtaaaacaggagccctggaaggcccagaagtggatgggtttgtcaaagacatgatggagcttgtccagcccagcatcagcggggtggaccttgataagttccgcgagattctcctgcgtcactgcgacgtgaacaaggatggaaaaattcagaagtctgagctggctttgtgtcttgggctgaaaatcaacccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily B, member 6
- DnaJ (Hsp40) homolog, subfamily B, member 5
- cadherin 6, type 2, K-cadherin (fetal kidney)
- cold shock domain containing E1, RNA-binding

Buy SCGN-secretagogin, EF-hand calcium binding protein Gene now

Add to cart