DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene View larger

DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene

Proteogenix catalog: PTXBC012115
Ncbi symbol: DNAJB5
Product name: DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene
Size: 2ug
Accessions: BC012115
Gene id: 25822
Gene description: DnaJ (Hsp40) homolog, subfamily B, member 5
Synonyms: dnaJ homolog subfamily B member 5; DnaJ (Hsp40) homolog, subfamily B, member 5; heat shock cognate 40; heat shock protein Hsp40-2; heat shock protein Hsp40-3; heat shock protein cognate 40; DnaJ heat shock protein family (Hsp40) member B5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaaagattattacaagattcttgggatcccatcgggggccaacgaggatgagatcaagaaagcctaccggaagatggccttgaagtaccacccagacaagaataaagaacccaacgctgaggagaagtttaaggagattgcagaggcctatgatgtgctaagtgaccccaagaaacggggcctgtatgaccagtatggggaggaaggcctgaagaccggcggtggcacatcaggtggctccagtggctcctttcactacacctttcatggggacccccatgccacctttgcctccttctttggtggctccaaccccttcgatatcttctttgccagcagccgctccactcggcccttcagtggctttgacccagatgacatggatgtggatgaagatgaggacccatttggcgctttcggccgttttggcttcaatgggctgagtaggggtccaaggcgagccccagaaccactgtaccctcggcgcaaggtgcaggaccccccagtggtgcacgagctgcgggtgtccctggaggagatctaccatggctccaccaagcgcatgaagatcacaaggcgtcgcctcaaccctgatgggcgaactgtgcgcaccgaggacaagatcctgcacatagtcatcaagcgtggctggaaggaaggcaccaagatcaccttccccaaagaaggcgacgccacacctgacaacatccctgctgacatcgtctttgtgctcaaagacaagccccatgcacacttccgccgagatggcaccaacgtgctctacagtgccctgatcagcctcaaggaggcgctgtgtggctgcactgtgaacattcccactatcgacggccgagtgatccctttgccctgcaatgatgtcatcaagccaggcaccgtgaagagactccgtggggagggccttcccttccccaaagtgccaactcagcgaggagacctcattgttgagttcaaagttcgcttcccagacagattaacaccacagacaagacagatccttaagcagcaatacccccaacactcactccactcaatgtgcacccagcttgatgtccactggacactggcaactttttctaaaatgcaaaaaaaagccactggttttcaggaaaatgttcctgtccctgaccccttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy DNAJB5-DnaJ (Hsp40) homolog, subfamily B, member 5 Gene now

Add to cart