Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CERCAM-cerebral endothelial cell adhesion molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CERCAM-cerebral endothelial cell adhesion molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011811 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CERCAM |
| Origin species: | Human |
| Product name: | CERCAM-cerebral endothelial cell adhesion molecule Gene |
| Size: | 2ug |
| Accessions: | BC011811 |
| Gene id: | 51148 |
| Gene description: | cerebral endothelial cell adhesion molecule |
| Synonyms: | CEECAM1; GLT25D3; cerebral cell adhesion molecule; cerebral endothelial cell adhesion molecule 1; glycosyltransferase 25 domain containing 3; glycosyltransferase 25 family member 3; cerebral endothelial cell adhesion molecule |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgcaaagcagtgtctaggagcaggccactactgcccagagagcagaggaggaggttgttggcagggactgcagatcctgtcagacctggccaccaccttgggcatggccactctgccctctggacctgtctttcatcgggagaaaccactcagagatggatcccattccctaaaggtctcacagcaaaggagcaggactcccaggcccctgtaccctgcctggcctgattcagggccttgtggcccccagcttctgtttcaagctgggcagaccccaggatcccttccctccctaaggactcagctgaggggcccctctgcccccttctacctccacctcagcaccctcccccagcttgatgtttgggtctccccagcaccctcctccctggccggtgcaaagtacagggaggtaaagcaggacccttgcagacatgttgcccagcacacagtaggccctcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - deoxythymidylate kinase (thymidylate kinase) - hydroxysteroid (17-beta) dehydrogenase 10 - secretagogin, EF-hand calcium binding protein - DnaJ (Hsp40) homolog, subfamily B, member 6 |