CERCAM-cerebral endothelial cell adhesion molecule Gene View larger

CERCAM-cerebral endothelial cell adhesion molecule Gene

PTXBC011811

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CERCAM-cerebral endothelial cell adhesion molecule Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CERCAM-cerebral endothelial cell adhesion molecule Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011811
Product type: DNA & cDNA
Ncbi symbol: CERCAM
Origin species: Human
Product name: CERCAM-cerebral endothelial cell adhesion molecule Gene
Size: 2ug
Accessions: BC011811
Gene id: 51148
Gene description: cerebral endothelial cell adhesion molecule
Synonyms: CEECAM1; GLT25D3; cerebral cell adhesion molecule; cerebral endothelial cell adhesion molecule 1; glycosyltransferase 25 domain containing 3; glycosyltransferase 25 family member 3; cerebral endothelial cell adhesion molecule
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgcaaagcagtgtctaggagcaggccactactgcccagagagcagaggaggaggttgttggcagggactgcagatcctgtcagacctggccaccaccttgggcatggccactctgccctctggacctgtctttcatcgggagaaaccactcagagatggatcccattccctaaaggtctcacagcaaaggagcaggactcccaggcccctgtaccctgcctggcctgattcagggccttgtggcccccagcttctgtttcaagctgggcagaccccaggatcccttccctccctaaggactcagctgaggggcccctctgcccccttctacctccacctcagcaccctcccccagcttgatgtttgggtctccccagcaccctcctccctggccggtgcaaagtacagggaggtaaagcaggacccttgcagacatgttgcccagcacacagtaggccctcaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - deoxythymidylate kinase (thymidylate kinase)
- hydroxysteroid (17-beta) dehydrogenase 10
- secretagogin, EF-hand calcium binding protein
- DnaJ (Hsp40) homolog, subfamily B, member 6

Buy CERCAM-cerebral endothelial cell adhesion molecule Gene now

Add to cart