DTYMK-deoxythymidylate kinase (thymidylate kinase) Gene View larger

DTYMK-deoxythymidylate kinase (thymidylate kinase) Gene

PTXBC001827

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DTYMK-deoxythymidylate kinase (thymidylate kinase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DTYMK-deoxythymidylate kinase (thymidylate kinase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001827
Product type: DNA & cDNA
Ncbi symbol: DTYMK
Origin species: Human
Product name: DTYMK-deoxythymidylate kinase (thymidylate kinase) Gene
Size: 2ug
Accessions: BC001827
Gene id: 1841
Gene description: deoxythymidylate kinase (thymidylate kinase)
Synonyms: CDC8; PP3731; TMPK; TYMK; thymidylate kinase; dTMP kinase; deoxythymidylate kinase (thymidylate kinase); deoxythymidylate kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcccggcgcggggctctcatagtgctggagggcgtggaccgcgccgggaagagcacgcagagccgcaagctggtggaagcgctgtgcgccgcgggccaccgcgccgaactgctccggttcccggaaagatcaactgaaatcggcaaacttctgagttcctacttgcaaaagaaaagtgacgtggaggatcactcggtgcacctgcttttttctgcaaatcgctgggaacaagtgccgttaattaaggaaaagttgagccagggcgtgaccctcgtcgtggacagatacgcattttctggtgtggccttcaccggtgccaaggagaatttttccctagactggtgtaaacagccagacgtgggccttcccaaacccgacctggtcctgttcctccagttacagctggcggatgctgccaagcggggagcgtttggccatgagcgctatgagaacggggctttccaggagcgggcgctccggtgtttccaccagctcatgaaagacacgactttgaactggaagatggtggatgcttccaaaagcatcgaagctgtccatgaggacatccgcgtgctctctgaggacgccatccgcactgccacagagaagccgctgggggagctatggaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydroxysteroid (17-beta) dehydrogenase 10
- secretagogin, EF-hand calcium binding protein
- DnaJ (Hsp40) homolog, subfamily B, member 6
- DnaJ (Hsp40) homolog, subfamily B, member 5

Buy DTYMK-deoxythymidylate kinase (thymidylate kinase) Gene now

Add to cart