C6orf48-chromosome 6 open reading frame 48 Gene View larger

C6orf48-chromosome 6 open reading frame 48 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf48-chromosome 6 open reading frame 48 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf48-chromosome 6 open reading frame 48 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017660
Product type: DNA & cDNA
Ncbi symbol: C6orf48
Origin species: Human
Product name: C6orf48-chromosome 6 open reading frame 48 Gene
Size: 2ug
Accessions: BC017660
Gene id: 50854
Gene description: chromosome 6 open reading frame 48
Synonyms: D6S57; protein G8; chromosome 6 open reading frame 48
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagaagctttgtatggctgtcatgcttagacagtgattcctgcaacttgaccttcaggctgggagaggtggagagccatgcctgttctccttccttgctatggaatttgctgacacaatatcttccgcctggtgctgggcatatcctaagaacttacaactttcctgtattatcctgtgtgagcagctgtcaccttattgggggaaaaatgcctgaaaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 97
- chromosome 8 open reading frame 40
- allograft inflammatory factor 1-like
- mitochondrial ribosomal protein S36

Buy C6orf48-chromosome 6 open reading frame 48 Gene now

Add to cart