Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene
PTXBC015975
New product
Data sheet of TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015975 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOMM6 |
| Origin species: | Human |
| Product name: | TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC015975 |
| Gene id: | 100188893 |
| Gene description: | translocase of outer mitochondrial membrane 6 homolog (yeast) |
| Synonyms: | 1110002E23Rik; AI663970; mitochondrial import receptor subunit TOM6 homolog; overexpressed breast tumor protein homolog; translocase of outer membrane 6 kDa subunit homolog; translocase of outer mitochondrial membrane 6 homolog (yeast) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttccagcactgtcccggtgagcgctgctggctcggctaatgaaactcccgaaataccggacaacgtgggagattggcttcggggcgtctaccgctttgccactgataggaatgacttccggaggaacttgatactaaatttgggactctttgctgcgggagtttggctggccaggaacttgagtgacattgacctcatggcacctcagccaggggtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - formation of mitochondrial complexes 1 homolog (S. cerevisiae) - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) - potassium voltage-gated channel, Isk-related family, member 4 |