Login to display prices
Login to display prices
TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene View larger

TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene

PTXBC015975

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015975
Product type: DNA & cDNA
Ncbi symbol: TOMM6
Origin species: Human
Product name: TOMM6-translocase of outer mitochondrial membrane 6 homolog (yeast) Gene
Size: 2ug
Accessions: BC015975
Gene id: 100188893
Gene description: translocase of outer mitochondrial membrane 6 homolog (yeast)
Synonyms: 1110002E23Rik; AI663970; mitochondrial import receptor subunit TOM6 homolog; overexpressed breast tumor protein homolog; translocase of outer membrane 6 kDa subunit homolog; translocase of outer mitochondrial membrane 6 homolog (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccagcactgtcccggtgagcgctgctggctcggctaatgaaactcccgaaataccggacaacgtgggagattggcttcggggcgtctaccgctttgccactgataggaatgacttccggaggaacttgatactaaatttgggactctttgctgcgggagtttggctggccaggaacttgagtgacattgacctcatggcacctcagccaggggtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - formation of mitochondrial complexes 1 homolog (S. cerevisiae)
- NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
- mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
- potassium voltage-gated channel, Isk-related family, member 4