MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene View larger

MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene

PTXBC009416

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009416
Product type: DNA & cDNA
Ncbi symbol: MRM1
Origin species: Human
Product name: MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009416
Gene id: 79922
Gene description: mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
Synonyms: rRNA methyltransferase 1, mitochondrial; 16S rRNA (guanosine(1145)-2'-O)-methyltransferase; 16S rRNA [Gm1145] 2'-O-methyltransferase; CTB-75G16.3; mitochondrial large ribosomal RNA ribose methylase; mitochondrial rRNA methyltransferase 1 homolog; mitochondrial rRNA methyltransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgtgttctccactgatgacctcaccggatttttacagaccaaagcccagcagggctggctcgtggccggcacggtgggctgcccaagcacagaggatccccagtcctccgagatccccatcatgagttgcttggagttcctctgggaacggcctactctccttgtgctggggaatgagggctcaggtctatcccaggaggtgcaggcctcctgccagcttctcctcaccatcctgccccggcgccagctgcctcctggacttgagtccttgaacgtctctgtggctgcaggaattcttcttcactccatttgcagccagaggaagggtttccccacagagggggagagaaggcagcttctccaagacccccaagaaccctcagccaggtctgaagggctcagcatggctcagcacccagggctgtcttcaggcccagagaaagagaggcaaaatgagggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium voltage-gated channel, Isk-related family, member 4
- protein kinase, AMP-activated, gamma 1 non-catalytic subunit
- protein phosphatase 2, regulatory subunit B', gamma isoform
- Cas-Br-M (murine) ecotropic retroviral transforming sequence b

Buy MRM1-mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Gene now

Add to cart