KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene View larger

KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014429
Product type: DNA & cDNA
Ncbi symbol: KCNE4
Origin species: Human
Product name: KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene
Size: 2ug
Accessions: BC014429
Gene id: 23704
Gene description: potassium voltage-gated channel, Isk-related family, member 4
Synonyms: MIRP3; potassium voltage-gated channel subfamily E member 4; MINK-related peptide 3; cardiac voltage-gated potassium channel accessory subunit 4; minimum potassium ion channel-related peptide 3; potassium channel subunit beta MiRP3; potassium channel, voltage gated subfamily E regulatory beta subunit 4; potassium voltage-gated channel, Isk-related family, member 4; potassium voltage-gated channel subfamily E regulatory subunit 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaaaatggagcctctgaacagcacgcaccccggcaccgccgcctccagcagccccctggagtcccgtgcggccggtggcggcagcggcaatggcaacgagtacttctacattctggttgtcatgtccttctacggcattttcttgatcggaatcatgctgggctacatgaaatccaagaggcgggagaagaagtccagcctcctgctgctgtacaaagacgaggagcggctctggggggaggccatgaagccgctgcccgtggtgtcgggcctgaggtcggtgcaggtgcccctgatgctgaacatgctgcaggagagcgtggcgcccgcgctgtcctgcaccctctgttccatggaaggggacagcgtgagctccgagtcctcctccccggacgtgcacctcaccattcaggaggagggggcagacgaggagctggaggagacctcggagacgcccctcaacgagagcagcgaagggtcctcggagaacatccatcagaattcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein kinase, AMP-activated, gamma 1 non-catalytic subunit
- protein phosphatase 2, regulatory subunit B', gamma isoform
- Cas-Br-M (murine) ecotropic retroviral transforming sequence b
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa

Buy KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene now

Add to cart