Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene
PTXBC014429
New product
Data sheet of KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014429 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNE4 |
| Origin species: | Human |
| Product name: | KCNE4-potassium voltage-gated channel, Isk-related family, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC014429 |
| Gene id: | 23704 |
| Gene description: | potassium voltage-gated channel, Isk-related family, member 4 |
| Synonyms: | MIRP3; potassium voltage-gated channel subfamily E member 4; MINK-related peptide 3; cardiac voltage-gated potassium channel accessory subunit 4; minimum potassium ion channel-related peptide 3; potassium channel subunit beta MiRP3; potassium channel, voltage gated subfamily E regulatory beta subunit 4; potassium voltage-gated channel, Isk-related family, member 4; potassium voltage-gated channel subfamily E regulatory subunit 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaaaatggagcctctgaacagcacgcaccccggcaccgccgcctccagcagccccctggagtcccgtgcggccggtggcggcagcggcaatggcaacgagtacttctacattctggttgtcatgtccttctacggcattttcttgatcggaatcatgctgggctacatgaaatccaagaggcgggagaagaagtccagcctcctgctgctgtacaaagacgaggagcggctctggggggaggccatgaagccgctgcccgtggtgtcgggcctgaggtcggtgcaggtgcccctgatgctgaacatgctgcaggagagcgtggcgcccgcgctgtcctgcaccctctgttccatggaaggggacagcgtgagctccgagtcctcctccccggacgtgcacctcaccattcaggaggagggggcagacgaggagctggaggagacctcggagacgcccctcaacgagagcagcgaagggtcctcggagaacatccatcagaattcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein kinase, AMP-activated, gamma 1 non-catalytic subunit - protein phosphatase 2, regulatory subunit B', gamma isoform - Cas-Br-M (murine) ecotropic retroviral transforming sequence b - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa |