NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene View larger

NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000813
Product type: DNA & cDNA
Ncbi symbol: NDUFA5
Origin species: Human
Product name: NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene
Size: 2ug
Accessions: BC000813
Gene id: 4698
Gene description: NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
Synonyms: B13; CI-13KD-B; CI-13kB; NUFM; UQOR13; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa; NADH-ubiquinone oxidoreductase 13 kDa-B subunit; complex I 13kDa subunit B; complex I subunit B13; type I dehydrogenase; ubiquinone reductase; NADH:ubiquinone oxidoreductase subunit A5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggtgtgctgaagaagaccactggccttgtgggattggctgtgtgcaatactcctcacgagaggctaagaatattgtacacaaagattcttgatgttcttgaggaaatccctaaaaatgcagcatatagaaagtatacagaacagattacaaatgagaagctggctatggttaaagcggaaccagatgttaaaaaattagaagaccaacttcaaggcggtcaattagaagaggtgattcttcaggctgaacatgaactaaatctggcaagaaaaatgagggaatggaaactatgggagccattagtggaagagcctcctgccgatcagtggaaatggccaatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DNA segment on chromosome 4 (unique) 234 expressed sequence
- nudix (nucleoside diphosphate linked moiety X)-type motif 21
- potassium voltage-gated channel, Isk-related family, member 3
- protein kinase, AMP-activated, gamma 2 non-catalytic subunit

Buy NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene now

Add to cart