Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene
PTXBC000813
New product
Data sheet of NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000813 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA5 |
| Origin species: | Human |
| Product name: | NDUFA5-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa Gene |
| Size: | 2ug |
| Accessions: | BC000813 |
| Gene id: | 4698 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa |
| Synonyms: | B13; CI-13KD-B; CI-13kB; NUFM; UQOR13; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa; NADH-ubiquinone oxidoreductase 13 kDa-B subunit; complex I 13kDa subunit B; complex I subunit B13; type I dehydrogenase; ubiquinone reductase; NADH:ubiquinone oxidoreductase subunit A5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggtgtgctgaagaagaccactggccttgtgggattggctgtgtgcaatactcctcacgagaggctaagaatattgtacacaaagattcttgatgttcttgaggaaatccctaaaaatgcagcatatagaaagtatacagaacagattacaaatgagaagctggctatggttaaagcggaaccagatgttaaaaaattagaagaccaacttcaaggcggtcaattagaagaggtgattcttcaggctgaacatgaactaaatctggcaagaaaaatgagggaatggaaactatgggagccattagtggaagagcctcctgccgatcagtggaaatggccaatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DNA segment on chromosome 4 (unique) 234 expressed sequence - nudix (nucleoside diphosphate linked moiety X)-type motif 21 - potassium voltage-gated channel, Isk-related family, member 3 - protein kinase, AMP-activated, gamma 2 non-catalytic subunit |