Login to display prices
Login to display prices
PRKAG2-protein kinase, AMP-activated, gamma 2 non-catalytic subunit Gene View larger

PRKAG2-protein kinase, AMP-activated, gamma 2 non-catalytic subunit Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRKAG2-protein kinase, AMP-activated, gamma 2 non-catalytic subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRKAG2-protein kinase, AMP-activated, gamma 2 non-catalytic subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020540
Product type: DNA & cDNA
Ncbi symbol: PRKAG2
Origin species: Human
Product name: PRKAG2-protein kinase, AMP-activated, gamma 2 non-catalytic subunit Gene
Size: 2ug
Accessions: BC020540
Gene id: 51422
Gene description: protein kinase, AMP-activated, gamma 2 non-catalytic subunit
Synonyms: AAKG; AAKG2; CMH6; H91620p; WPWS; 5'-AMP-activated protein kinase subunit gamma-2; AMPK subunit gamma-2; protein kinase, AMP-activated, gamma 2 non-catalytic subunit; protein kinase AMP-activated non-catalytic subunit gamma 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggagaagctggagttcgaggacgaagcagtagaagactcagaaagtggtgtttacatgcgattcatgaggtcacacaagtgttatgacatcgttccaaccagttcaaagcttgttgtctttgatactacattacaagttaaaaaggccttctttgctttggtagccaacggtgtccgagcagcgccactgtgggagagtaaaaaacaaagttttgtaggaatgctaacaattacagatttcataaatatactacatagatactataaatcacctatggtacagatttatgaattagaggaacataaaattgaaacatggagggagctttatttacaagaaacatttaagcctttagtgaatatatctccagatgcaagcctcttcgatgctgtatactccttgatcaaaaataaaatccacagattgcccgttattgaccctatcagtgggaatgcactttatatacttacccacaaaagaatcctcaagttcctccagctttttatgtctgatatgccaaagcctgccttcatgaagcagaacctggatgagcttggaataggaacgtaccacaacattgccttcatacatccagacactcccatcatcaaagccttgaacatatttgtggaaagacgaatatcagctctgcctgttgtggatgagtcaggaaaagttgtagatatttattccaaatttgatgtaattaatcttgctgctgagaaaacatacaataacctagatatcacggtgacccaggcccttcagcaccgttcacagtattttgaaggtgttgtgaagtgcaataagctggaaatactggagaccatcgtggacagaatagtaagagctgaggtccatcggctggtggtggtaaatgaagcagatagtattgtgggtattatttccctgtcggacattctgcaagccctgatcctcacaccagcaggtgccaaacaaaaggagacagaaacggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dolichyl-diphosphooligosaccharide-protein glycosyltransferase
- Cas-Br-M (murine) ecotropic retroviral transforming sequence c
- solute carrier organic anion transporter family, member 6A1
- translocase of inner mitochondrial membrane 9 homolog (yeast)