Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene
PTXBC028915
New product
Data sheet of CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028915 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CBLC |
| Origin species: | Human |
| Product name: | CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene |
| Size: | 2ug |
| Accessions: | BC028915 |
| Gene id: | 23624 |
| Gene description: | Cas-Br-M (murine) ecotropic retroviral transforming sequence c |
| Synonyms: | CBL-3; CBL-SL; RNF57; E3 ubiquitin-protein ligase CBL-C; Cas-Br-M (murine) ecotropic retroviral transforming sequence c; Cas-Br-M (murine) ectropic retroviral transforming sequence c; Cbl proto-oncogene C, E3 ubiquitin protein ligase; Cbl proto-oncogene, E3 ubiquitin protein ligase C; RING finger protein 57; SH3-binding protein CBL-3; SH3-binding protein CBL-C; signal transduction protein CBL-C; Cbl proto-oncogene C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctctggcggtggccccgtgggggcgacagtgggaagaggcccgcgccctgggccgggcagtcaggatgctgcagcgcctagaagagcaatgcgtcgacccccggctgtccgtgagtcccccttcgctgcgggacctgctgccccgcacagcgcagctgcttcgagaggtggcccattctcggcgggcggccggcggaggcggccccgggggtcccggcggctctggggactttctactcatctacctggccaatctggaggccaagagcaggcaggtggccgcgctgctgcctccccggggccgaaggagtgccaacgacgagctcttccgggcgggctccagactcaggcgacagctggccaagctggccatcatcttcagccacatgcacgcagagctgcacgcactcttccccgggggaaagtactgtggacacatgtaccagctcaccaaggcccccgcccacaccttctggagggaaagttgcggagcccggtgtgtgctgccctgggctgagtttgagtccctcctgggcacctgccaccctgtggaaccaggctgcacagccctggccttgcgcaccaccattgacctcacctgcagcgggcacgtgtccatcttcgagttcgacgtcttcaccaggctctttcagccatggccaacactcctcaagaactggcagctcctggcagtcaaccacccaggctacatggccttcctcacctatgatgaggtccaagagcgtctgcaggcctgcagggacaagccaggcagttacatcttccggcccagctgtactcgcctggggcagtgggccatcggctatgtgagctcagatggcagcatcctgcagaccatccctgccaacaaacccctgtcccaggtgctcctggagggacagaaggacggcttctacctctacccagatggaaagacccacaacccagacctgactgagctcggccaggcagaaccccagcagcgcatccacgtgtcagaggagcagctgcagctctactgggccatggactccacatttgagctctgcaagatctgtgctgagagcaacaaggatgtgaagattgagccgtgcgggcacctgctctgcagctgctgcctggctgcctggcagcactcggacagccagacctgccccttctgccgctgcgagatcaagggctgggaggccgtgagtatctaccagttccacggtcaggctactgctgaggacccagggaacagcagtgaccaggaaggcagggagttggagctggggcaggtgcccctttcggctcctccattgcccccacggccagatctgccccccaggaagcccagaaatgcccagccgaaagtgagactcctaaaggggaactcccctccagctgcgctgggaccccaggaccctgccccggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier organic anion transporter family, member 6A1 - translocase of inner mitochondrial membrane 9 homolog (yeast) - potassium voltage-gated channel, Isk-related family, member 1 - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) |