CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene View larger

CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028915
Product type: DNA & cDNA
Ncbi symbol: CBLC
Origin species: Human
Product name: CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene
Size: 2ug
Accessions: BC028915
Gene id: 23624
Gene description: Cas-Br-M (murine) ecotropic retroviral transforming sequence c
Synonyms: CBL-3; CBL-SL; RNF57; E3 ubiquitin-protein ligase CBL-C; Cas-Br-M (murine) ecotropic retroviral transforming sequence c; Cas-Br-M (murine) ectropic retroviral transforming sequence c; Cbl proto-oncogene C, E3 ubiquitin protein ligase; Cbl proto-oncogene, E3 ubiquitin protein ligase C; RING finger protein 57; SH3-binding protein CBL-3; SH3-binding protein CBL-C; signal transduction protein CBL-C; Cbl proto-oncogene C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctctggcggtggccccgtgggggcgacagtgggaagaggcccgcgccctgggccgggcagtcaggatgctgcagcgcctagaagagcaatgcgtcgacccccggctgtccgtgagtcccccttcgctgcgggacctgctgccccgcacagcgcagctgcttcgagaggtggcccattctcggcgggcggccggcggaggcggccccgggggtcccggcggctctggggactttctactcatctacctggccaatctggaggccaagagcaggcaggtggccgcgctgctgcctccccggggccgaaggagtgccaacgacgagctcttccgggcgggctccagactcaggcgacagctggccaagctggccatcatcttcagccacatgcacgcagagctgcacgcactcttccccgggggaaagtactgtggacacatgtaccagctcaccaaggcccccgcccacaccttctggagggaaagttgcggagcccggtgtgtgctgccctgggctgagtttgagtccctcctgggcacctgccaccctgtggaaccaggctgcacagccctggccttgcgcaccaccattgacctcacctgcagcgggcacgtgtccatcttcgagttcgacgtcttcaccaggctctttcagccatggccaacactcctcaagaactggcagctcctggcagtcaaccacccaggctacatggccttcctcacctatgatgaggtccaagagcgtctgcaggcctgcagggacaagccaggcagttacatcttccggcccagctgtactcgcctggggcagtgggccatcggctatgtgagctcagatggcagcatcctgcagaccatccctgccaacaaacccctgtcccaggtgctcctggagggacagaaggacggcttctacctctacccagatggaaagacccacaacccagacctgactgagctcggccaggcagaaccccagcagcgcatccacgtgtcagaggagcagctgcagctctactgggccatggactccacatttgagctctgcaagatctgtgctgagagcaacaaggatgtgaagattgagccgtgcgggcacctgctctgcagctgctgcctggctgcctggcagcactcggacagccagacctgccccttctgccgctgcgagatcaagggctgggaggccgtgagtatctaccagttccacggtcaggctactgctgaggacccagggaacagcagtgaccaggaaggcagggagttggagctggggcaggtgcccctttcggctcctccattgcccccacggccagatctgccccccaggaagcccagaaatgcccagccgaaagtgagactcctaaaggggaactcccctccagctgcgctgggaccccaggaccctgccccggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier organic anion transporter family, member 6A1
- translocase of inner mitochondrial membrane 9 homolog (yeast)
- potassium voltage-gated channel, Isk-related family, member 1
- NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)

Buy CBLC-Cas-Br-M (murine) ecotropic retroviral transforming sequence c Gene now

Add to cart