KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene View larger

KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036452
Product type: DNA & cDNA
Ncbi symbol: KCNE1
Origin species: Human
Product name: KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene
Size: 2ug
Accessions: BC036452
Gene id: 3753
Gene description: potassium voltage-gated channel, Isk-related family, member 1
Synonyms: ISK; JLNS; JLNS2; LQT2/5; LQT5; MinK; potassium voltage-gated channel subfamily E member 1; IKs producing slow voltage-gated potassium channel subunit beta Mink; cardiac delayed rectifier potassium channel protein; delayed rectifier potassium channel subunit IsK; minimal potassium channel; potassium channel, voltage gated subfamily E regulatory beta subunit 1; potassium voltage-gated channel, Isk-related family, member 1; potassium voltage-gated channel, Isk-related subfamily, member 1; voltage gated potassiun channel accessory subunit; potassium voltage-gated channel subfamily E regulatory subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcctgtctaacaccacagcggtgacgccctttctgaccaagctgtggcaggagacagttcagcagggtggcaacatgtcgggcctggcccacaggtccccccgcagcggtgacggcaagctggaggccctctacgtcctcatggtactgggattcttcggcttcttcaccctgggcatcatgctgagctacatccgctccaagaagctggagcactcgaacgacccattcaacgtctacatcgagtccgatgcctggcaagagaaggacaaggcctatgtccaggcccgggtcctggagagctacaggtcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
- nudix (nucleoside diphosphate linked moiety X)-type motif 11
- nudix (nucleoside diphosphate linked moiety X)-type motif 22

Buy KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene now

Add to cart