Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene
PTXBC036452
New product
Data sheet of KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036452 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNE1 |
| Origin species: | Human |
| Product name: | KCNE1-potassium voltage-gated channel, Isk-related family, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC036452 |
| Gene id: | 3753 |
| Gene description: | potassium voltage-gated channel, Isk-related family, member 1 |
| Synonyms: | ISK; JLNS; JLNS2; LQT2/5; LQT5; MinK; potassium voltage-gated channel subfamily E member 1; IKs producing slow voltage-gated potassium channel subunit beta Mink; cardiac delayed rectifier potassium channel protein; delayed rectifier potassium channel subunit IsK; minimal potassium channel; potassium channel, voltage gated subfamily E regulatory beta subunit 1; potassium voltage-gated channel, Isk-related family, member 1; potassium voltage-gated channel, Isk-related subfamily, member 1; voltage gated potassiun channel accessory subunit; potassium voltage-gated channel subfamily E regulatory subunit 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcctgtctaacaccacagcggtgacgccctttctgaccaagctgtggcaggagacagttcagcagggtggcaacatgtcgggcctggcccacaggtccccccgcagcggtgacggcaagctggaggccctctacgtcctcatggtactgggattcttcggcttcttcaccctgggcatcatgctgagctacatccgctccaagaagctggagcactcgaacgacccattcaacgtctacatcgagtccgatgcctggcaagagaaggacaaggcctatgtccaggcccgggtcctggagagctacaggtcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa - nudix (nucleoside diphosphate linked moiety X)-type motif 11 - nudix (nucleoside diphosphate linked moiety X)-type motif 22 |