Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA6-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa Gene
PTXBC002772
New product
Data sheet of NDUFA6-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA6-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002772 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA6 |
| Origin species: | Human |
| Product name: | NDUFA6-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa Gene |
| Size: | 2ug |
| Accessions: | BC002772 |
| Gene id: | 4700 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa |
| Synonyms: | B14; CI-B14; LYRM6; NADHB14; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 6; Complex I-B14; LYR motif-containing protein 6; NADH-ubiquinone oxidoreductase 1 alpha subcomplex, 6; NADH-ubiquinone oxidoreductase B14 subunit; NADH:ubiquinone oxidoreductase subunit A6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggggagcggcgtccgccaagctacttctaccgccagcaccttcgtgaagcccattttcagtcgggacatgaacgaggccaagcggagggtgcgcgagctctaccgcgcctggtatcgggaggtgccgaacactgtgcaccaattccagctggacatcactgtgaaaatgggacgggataaagtccgagaaatgtttatgaagaatgcccatgtcacagaccccagggtggttgatcttctggtcattaagggaaagatcgaactggaagaaacaattaaagtatggaagcagcggacacatgttatgcggttcttccatgaaacagaagcgccaaggccaaaggatttcctatccaagttctatgttggccacgatccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 11 - nudix (nucleoside diphosphate linked moiety X)-type motif 22 - aldo-keto reductase family 1, member B10 (aldose reductase) - nudix (nucleoside diphosphate linked moiety X)-type motif 18 |