NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene View larger

NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006129
Product type: DNA & cDNA
Ncbi symbol: NUDT22
Origin species: Human
Product name: NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene
Size: 2ug
Accessions: BC006129
Gene id: 84304
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 22
Synonyms: nucleoside diphosphate-linked moiety X motif 22; nudix (nucleoside diphosphate linked moiety X)-type motif 22; nudix motif 22; nudix hydrolase 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcctgaggtgaccttgctgctgcagtgccctggcgggggcctgccccaggagcagatacaggccgagctgagccccgcccatgaccgtcgcccactgccaggtggggacgaggccatcactgccatctgggagacccggctaaaggcccaaccctggctcttcgacgcccccaagttccgcctgcactcagccaccctggcgcctattggctctcgggggccacagctgctcctgcgcctgggccttacttcctaccgagacttcctgggcaccaactggtccagctcagctgcctggctgcgacagcagggtgccaccgactggggtgacacgcaggcctatctggcggacccactgggggtgggcgctgcactagccacagccgatgacttccttgtcttcctgcgccgctcccggcaggtggctgaggcccctgggctggtggacgtacctggtgggcaccctgagcctcaggccctgtgccctggtggcagcccccagcaccaggacctcgctgggcagctggtggtacatgaactcttttccagtgtccttcaggagatctgtgatgaggtgaacctgccgctgctcaccctgagccagcccctgctgttgggcatcgcccgaaatgagaccagtgctggccgagccagtgccgagttctatgtccagtgcagcctgacttctgagcaggtgaggaagcactacctgagtgggggacccgaggcccacgagtctacaggaatcttctttgtggagacacagaacgtgcggagattgcccgagacggagatgtgggctgaactctgcccctcggccaaaggcgccatcatcctctacaaccgggttcagggaagtcccactggagcggccctagggtccccagccctactcccgccgctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldo-keto reductase family 1, member B10 (aldose reductase)
- nudix (nucleoside diphosphate linked moiety X)-type motif 18
- aldo-keto reductase family 1, member A1 (aldehyde reductase)
- beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)

Buy NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene now

Add to cart