Login to display prices
Login to display prices
NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene View larger

NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene

PTXBC006129

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene

Proteogenix catalog: PTXBC006129
Ncbi symbol: NUDT22
Product name: NUDT22-nudix (nucleoside diphosphate linked moiety X)-type motif 22 Gene
Size: 2ug
Accessions: BC006129
Gene id: 84304
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 22
Synonyms: nucleoside diphosphate-linked moiety X motif 22; nudix (nucleoside diphosphate linked moiety X)-type motif 22; nudix motif 22; nudix hydrolase 22
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcctgaggtgaccttgctgctgcagtgccctggcgggggcctgccccaggagcagatacaggccgagctgagccccgcccatgaccgtcgcccactgccaggtggggacgaggccatcactgccatctgggagacccggctaaaggcccaaccctggctcttcgacgcccccaagttccgcctgcactcagccaccctggcgcctattggctctcgggggccacagctgctcctgcgcctgggccttacttcctaccgagacttcctgggcaccaactggtccagctcagctgcctggctgcgacagcagggtgccaccgactggggtgacacgcaggcctatctggcggacccactgggggtgggcgctgcactagccacagccgatgacttccttgtcttcctgcgccgctcccggcaggtggctgaggcccctgggctggtggacgtacctggtgggcaccctgagcctcaggccctgtgccctggtggcagcccccagcaccaggacctcgctgggcagctggtggtacatgaactcttttccagtgtccttcaggagatctgtgatgaggtgaacctgccgctgctcaccctgagccagcccctgctgttgggcatcgcccgaaatgagaccagtgctggccgagccagtgccgagttctatgtccagtgcagcctgacttctgagcaggtgaggaagcactacctgagtgggggacccgaggcccacgagtctacaggaatcttctttgtggagacacagaacgtgcggagattgcccgagacggagatgtgggctgaactctgcccctcggccaaaggcgccatcatcctctacaaccgggttcagggaagtcccactggagcggccctagggtccccagccctactcccgccgctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: