AKR1A1-aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene View larger

AKR1A1-aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene

PTXBC000670

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKR1A1-aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AKR1A1-aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000670
Product type: DNA & cDNA
Ncbi symbol: AKR1A1
Origin species: Human
Product name: AKR1A1-aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene
Size: 2ug
Accessions: BC000670
Gene id: 10327
Gene description: aldo-keto reductase family 1, member A1 (aldehyde reductase)
Synonyms: ALDR1; ALR; ARM; DD3; HEL-S-6; alcohol dehydrogenase [NADP(+)]; HEL-S-165mP; alcohol dehydrogenase; dihydrodiol dehydrogenase 3; epididymis secretory protein Li 6; epididymis secretory sperm binding protein Li 165mP; aldo-keto reductase family 1 member A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcttcctgtgttctactgcacactgggcagaagatgcctctgattggtctgggtacctggaagagtgagcctggtcaggtaaaagcagctgttaagtatgcccttagcgtaggctaccgccacattgattgtgctgctatctacggcaatgagcctgagattggggaggccctgaaggaggacgtgggaccaggcaaggcggtgcctcgggaggagctgtttgtgacatccaagctgtggaacaccaagcaccaccccgaggatgtggagcctgccctccggaagactctggctgacctccagctggagtatctggacctgtacctgatgcactggccttatgcctttgagcggggagacaaccccttccccaagaatgctgatgggactatatgctacgactccacccactacaaggagacttggaaggctctggaggcactggtggctaaggggctggtgcaggcgctgggcctgtccaacttcaacagtcggcagattgatgacatactcagtgtggcctccgtgcgtccagctgtcttgcaggtggaatgccacccatacttggctcaaaatgagctaattgcccactgccaagcacgtggcctggaggtaactgcttatagccctttgggctcctctgatcgtgcatggcgtgatcctgatgagcctgtcctgctggaggaaccagtagtcctggcattggctgaaaagtatggccgatctccagctcagatcttgctcaggtggcaggtccagcggaaagtgatctgcatccccaaaagtatcactccttctcgaatccttcagaacatcaaggtgtttgacttcacctttagcccagaagagatgaagcagctaaatgccctgaacaaaaattggagatatattgtgcctatgcttacggtggatgggaagagagtcccaagggatgcagggcatcctctgtacccctttaatgacccgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
- nudE nuclear distribution gene E homolog (A. nidulans)-like 1
- arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa

Buy AKR1A1-aldo-keto reductase family 1, member A1 (aldehyde reductase) Gene now

Add to cart