Login to display prices
Login to display prices
B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene View larger

B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene

PTXBC007906

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene

Proteogenix catalog: PTXBC007906
Ncbi symbol: B3GAT3
Product name: B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene
Size: 2ug
Accessions: BC007906
Gene id: 26229
Gene description: beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Synonyms: GLCATI; JDSCD; glcUAT-I; galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3; Sqv-8-like protein; UDP-GlcUA:Gal beta-1,3-Gal-R glucuronyltransferase; beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I); beta-1,3-glucuronyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgaagctgaagaacgtgtttctcgcctacttcctggtgtcgatcgccggcctcctctacgcgctggtacagctcggccagccatgtgactgccttcctcccctgcgggcagcagccgagcagctacggcagaaggatctgaggatttcccagctgcaagcggaactccgacggccaccccctgcccctgcccagccccctgaacccgaggccctgcctactatctatgttgttacccccacctatgccaggctggtacagaaggcagagctggtacgactgtcccagacactgagcctggtgccccggctgcattggctgctggtggaggatgctgagggtcccaccccgctggtctcagggctgctggctgcctctggcctcctcttcacacacctggtggtcctcacgcccaaagcccagcggcttcgggagggcgagcctggctgggttcatccccgtggtgtcgagcagcggaacaaggccctggactggctccggggcagagggggtgctgtgggtggggagaaggacccaccaccaccagggacccaaggagtcgtctactttgctgacgatgacaacacctacagccgggagctgtttgaggagatgcgctggacccgtggtgtctcagtgtggcctgtggggctggtgggcggcctgcgattcgagggccctcaggtacaggacggccgggtagtgggcttccacacagcatgggagcccagcaggcccttccctgtggatatggctggatttgccgtggccctgcccttgctgttagataagcccaatgcccaatttgattccaccgctccccggggccacctggagagcagtcttctgagccaccttgtggatcccaaggacctggagccacgggctgccaactgcactcgggtactggtgtggcatactcggacagagaagcccaagatgaagcaggaggagcagctgcagcggcagggccggggctcagacccagcaattgaggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: