B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene View larger

B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007906
Product type: DNA & cDNA
Ncbi symbol: B3GAT3
Origin species: Human
Product name: B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene
Size: 2ug
Accessions: BC007906
Gene id: 26229
Gene description: beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)
Synonyms: GLCATI; JDSCD; glcUAT-I; galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3; Sqv-8-like protein; UDP-GlcUA:Gal beta-1,3-Gal-R glucuronyltransferase; beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I); beta-1,3-glucuronyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgaagctgaagaacgtgtttctcgcctacttcctggtgtcgatcgccggcctcctctacgcgctggtacagctcggccagccatgtgactgccttcctcccctgcgggcagcagccgagcagctacggcagaaggatctgaggatttcccagctgcaagcggaactccgacggccaccccctgcccctgcccagccccctgaacccgaggccctgcctactatctatgttgttacccccacctatgccaggctggtacagaaggcagagctggtacgactgtcccagacactgagcctggtgccccggctgcattggctgctggtggaggatgctgagggtcccaccccgctggtctcagggctgctggctgcctctggcctcctcttcacacacctggtggtcctcacgcccaaagcccagcggcttcgggagggcgagcctggctgggttcatccccgtggtgtcgagcagcggaacaaggccctggactggctccggggcagagggggtgctgtgggtggggagaaggacccaccaccaccagggacccaaggagtcgtctactttgctgacgatgacaacacctacagccgggagctgtttgaggagatgcgctggacccgtggtgtctcagtgtggcctgtggggctggtgggcggcctgcgattcgagggccctcaggtacaggacggccgggtagtgggcttccacacagcatgggagcccagcaggcccttccctgtggatatggctggatttgccgtggccctgcccttgctgttagataagcccaatgcccaatttgattccaccgctccccggggccacctggagagcagtcttctgagccaccttgtggatcccaaggacctggagccacgggctgccaactgcactcgggtactggtgtggcatactcggacagagaagcccaagatgaagcaggaggagcagctgcagcggcagggccggggctcagacccagcaattgaggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudE nuclear distribution gene E homolog (A. nidulans)-like 1
- arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa
- angiotensinogen (serpin peptidase inhibitor, clade A, member 8)

Buy B3GAT3-beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene now

Add to cart