Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDEL1-nudE nuclear distribution gene E homolog (A. nidulans)-like 1 Gene
PTXBC026101
New product
Data sheet of NDEL1-nudE nuclear distribution gene E homolog (A. nidulans)-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDEL1-nudE nuclear distribution gene E homolog (A. nidulans)-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026101 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDEL1 |
| Origin species: | Human |
| Product name: | NDEL1-nudE nuclear distribution gene E homolog (A. nidulans)-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC026101 |
| Gene id: | 81565 |
| Gene description: | nudE nuclear distribution gene E homolog (A. nidulans)-like 1 |
| Synonyms: | EOPA; MITAP1; NDE1L1; NDE2; nuclear distribution protein nudE-like 1; endooligopeptidase A; mitosin-associated protein 1; mitosin-associated protein MITAP1; nudE nuclear distribution E homolog-like 1; nudE nuclear distribution gene E homolog-like 1; protein Nudel; nudE neurodevelopment protein 1 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggtgaagatataccagatttttcaagtttaaaggaggaaactgcttattggaaggaactttccttgaagtataagcaaagcttccaggaagctcgggatgagctagttgaattccaggaaggaagcagagaattagaagcagagttggaggcacaattagtacaggctgaacaaagaaatagagacttgcaggctgataaccaaagactgaaatatgaagtggaggcattaaaggagaagctagagcatcaatatgcacagagctataagcaggtctcagtgttagaagatgatttaagtcagactcgggccattaaggagcagttgcataagtatgtgagagagctggagcaggccaacgacgacctggagcgagccaaaagggcaacaatagtttcactggaagactttgaacaaaggctaaaccaggccattgaacgaaatgcatttttagaaagtgaacttgatgaaaaggaatctttgttggtctctgtacagaggttaaaggatgaagcaagagatttaaggcaagaactagcagttcgggaaagacaacaggaagtaactagaaagtcggctcctagctctccaactctagactgtgaaaagatggactccgccgtccaagcatcactttctttgccagctacccctgttggcaaaggaacggagaacacttttccttcaccgaaagctataccaaatggttttggtaccagtccactaactccctctgctaggatatcagcactaaacatcgtgggggatctcttacggaaagtaggggctttagaatccaaattagcagcttgcaggaattttgcaaaggaccaagcatcacgaaaatcctatatttcagggaatgttaactgtggggtgctgaatggcaatggcacaaagttctctcgatcagggcatacatctttcttcgacaaaggggcagtaaacggctttgacacagctcctcctcctcctggtctgggctcctcgcgtccatcgtcagcgccgggtatgctacctctcagtgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa - angiotensinogen (serpin peptidase inhibitor, clade A, member 8) - ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 |