ATP6V1B2-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 Gene View larger

ATP6V1B2-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 Gene


New product

Data sheet of ATP6V1B2-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V1B2-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030640
Product type: DNA & cDNA
Ncbi symbol: ATP6V1B2
Origin species: Human
Product name: ATP6V1B2-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 Gene
Size: 2ug
Accessions: BC030640
Gene id: 526
Gene description: ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Synonyms: ATP6B1B2; ATP6B2; DOOD; HO57; VATB; VPP3; Vma2; ZLS2; V-type proton ATPase subunit B, brain isoform; ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2; H+ transporting two-sector ATPase; V-ATPase B2 subunit; V-ATPase subunit B 2; endomembrane proton pump 58 kDa subunit; testicular secretory protein Li 65; vacuolar H+-ATPase 56,000 subunit; vacuolar proton pump subunit B 2; ATPase H+ transporting V1 subunit B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgcgggcgatgcgggggattgtcaacggggccgcacccgagctacccgtgcccaccggtgggccggcggtgggagctcaggagcaggcgctggcagtcagtcggaactacctctcccagcctcgcctcacatacaagacagtatctggagtcaatggtccactagtgatcttagatcatgttaagtttcccaggtatgctgaaattgtccatttgaccttaccggatggcacaaagagaagtgggcaagttctggaagttagtggttccaaggcagtagttcaggtatttgaagggacttcaggtatagatgctaagaaaacgtcctgtgagtttactggggatattctccgaacaccggtgtctgaggatatgcttggtcgggtattcaatggatcgggaaaacccattgacagaggtcctgttgtactggccgaagacttccttgatatcatgggtcagccaatcaaccctcaatgtcgaatctacccagaggaaatgattcggactggcatttcggccatcgatgggatgaacagtattgctagggggcagaaaattcctatcttctctgctgctgggctaccacacaatgagattgcagctcagatctgtcgccaggctggtttggtaaagaaatccaaagatgtagtagactacagtgaggaaaattttgcaattgtatttgctgctatgggtgtaaacatggaaactgcccggttcttcaaatctgactttgaagaaaatggctcaatggacaatgtctgcctctttttgaacttggctaatgacccaaccattgagcgaattatcactcctcgcctggctctaaccacagctgaatttctggcgtaccaatgtgagaaacatgtattggttattctaacagacatgagttcttatgctgaagcacttcgagaggtttcagcagccagggaagaggtacctggtcgacgaggttttccaggttacatgtatacagatttagccacgatatatgaacgcgctgggcgagtgggagggagaaacggctcgattactcaaatccctattctaaccatgcctaatgatgatatcactcaccccatcccagacttgactggctacattacagaggggcagatctatgtggacagacagctgcacaacagacagatttatccacctatcaatgtgctgccctcactatcacggttaatgaagtctgctattggagaagggatgaccaggaaggatcatgccgatgtatctaaccagctatatgcgtgctatgctattggaaaggatgtgcaagccatgaaagctgtcgttggagaagaagcccttacctcagatgatcttctctacttggaatttctgcagaagtttgagaggaacttcattgctcagggtccttacgaaaatcgcactgtctttgagactttggacattggctggcagctactccgaatcttccccaaagaaatgctgaagagaatccctcagagcaccctcagcgaattttaccctcgagactctgcaaagcattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 33 (acetyl-CoA transporter), member 1
- retinitis pigmentosa GTPase regulator interacting protein 1
- solute carrier organic anion transporter family, member 3A1
- solute carrier organic anion transporter family, member 4A1

Buy ATP6V1B2-ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 Gene now

Add to cart