NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene View larger

NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009942
Product type: DNA & cDNA
Ncbi symbol: NUDT11
Origin species: Human
Product name: NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene
Size: 2ug
Accessions: BC009942
Gene id: 55190
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 11
Synonyms: APS1; ASP1; DIPP3b; DIPP3beta; hDIPP3beta; diphosphoinositol polyphosphate phosphohydrolase 3-beta; DIPP-3-beta; DIPP3-beta; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 3-beta; diadenosine hexaphosphate hydrolase (AMP-forming); diphosphoinositol polyphosphate phosphohydrolase 3, beta; hAps1; nucleoside diphosphate-linked moiety X motif 11; nudix (nucleoside diphosphate linked moiety X)-type motif 11; nudix motif 11; nudix hydrolase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtgcaaacccaaccagacgcggacctacgaccccgaggggttcaagaagcgggcggcgtgcctgtgcttccggagcgaacgcgaggacgaggtcctgttagtgagtagcagccggtacccggaccgctggatcgtgccgggcgggggcatggagcccgaggaggagccgggcggtgcggcggtccgagaggtgtacgaagaagcgggagtcaaggggaagttaggccggctcctgggcgtcttcgaacagaaccaggatcgcaagcacagaacgtacgtgtatgtactgactgtcacggagctgctggaggattgggaagattcggttagcattgggaggaagcgagagtggttcaaagtcgaagatgccatcaaggttctccagtgccacaagcccgtgcacgccgaatatctggagaaactaaagctgggcggttccccaaccaatggaaactccatggccccatcctcgccagatagcgatccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudix (nucleoside diphosphate linked moiety X)-type motif 22
- aldo-keto reductase family 1, member B10 (aldose reductase)
- nudix (nucleoside diphosphate linked moiety X)-type motif 18
- aldo-keto reductase family 1, member A1 (aldehyde reductase)

Buy NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene now

Add to cart