Login to display prices
Login to display prices
NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene View larger

NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene

PTXBC009942

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene

Proteogenix catalog: PTXBC009942
Ncbi symbol: NUDT11
Product name: NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene
Size: 2ug
Accessions: BC009942
Gene id: 55190
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 11
Synonyms: APS1; ASP1; DIPP3b; DIPP3beta; hDIPP3beta; diphosphoinositol polyphosphate phosphohydrolase 3-beta; DIPP-3-beta; DIPP3-beta; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 3-beta; diadenosine hexaphosphate hydrolase (AMP-forming); diphosphoinositol polyphosphate phosphohydrolase 3, beta; hAps1; nucleoside diphosphate-linked moiety X motif 11; nudix (nucleoside diphosphate linked moiety X)-type motif 11; nudix motif 11; nudix hydrolase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtgcaaacccaaccagacgcggacctacgaccccgaggggttcaagaagcgggcggcgtgcctgtgcttccggagcgaacgcgaggacgaggtcctgttagtgagtagcagccggtacccggaccgctggatcgtgccgggcgggggcatggagcccgaggaggagccgggcggtgcggcggtccgagaggtgtacgaagaagcgggagtcaaggggaagttaggccggctcctgggcgtcttcgaacagaaccaggatcgcaagcacagaacgtacgtgtatgtactgactgtcacggagctgctggaggattgggaagattcggttagcattgggaggaagcgagagtggttcaaagtcgaagatgccatcaaggttctccagtgccacaagcccgtgcacgccgaatatctggagaaactaaagctgggcggttccccaaccaatggaaactccatggccccatcctcgccagatagcgatccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice