Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene
PTXBC020213
New product
Data sheet of TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020213 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM9 |
| Origin species: | Human |
| Product name: | TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC020213 |
| Gene id: | 26520 |
| Gene description: | translocase of inner mitochondrial membrane 9 homolog (yeast) |
| Synonyms: | TIM9; TIM9A; mitochondrial import inner membrane translocase subunit Tim9; translocase of inner mitochondrial membrane 9 homolog; translocase of inner mitochondrial membrane 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaatgacacaaagaatatccatgagatttcaggaatatcatattcagcagaatgaagccctggcagccaaagcaggactccttggccaaccacgatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, Isk-related family, member 1 - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa - nudix (nucleoside diphosphate linked moiety X)-type motif 11 |