TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene View larger

TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020213
Product type: DNA & cDNA
Ncbi symbol: TIMM9
Origin species: Human
Product name: TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene
Size: 2ug
Accessions: BC020213
Gene id: 26520
Gene description: translocase of inner mitochondrial membrane 9 homolog (yeast)
Synonyms: TIM9; TIM9A; mitochondrial import inner membrane translocase subunit Tim9; translocase of inner mitochondrial membrane 9 homolog; translocase of inner mitochondrial membrane 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaatgacacaaagaatatccatgagatttcaggaatatcatattcagcagaatgaagccctggcagccaaagcaggactccttggccaaccacgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium voltage-gated channel, Isk-related family, member 1
- NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
- nudix (nucleoside diphosphate linked moiety X)-type motif 11

Buy TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene now

Add to cart