Login to display prices
Login to display prices
TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene View larger

TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene

PTXBC020213

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene

Proteogenix catalog: PTXBC020213
Ncbi symbol: TIMM9
Product name: TIMM9-translocase of inner mitochondrial membrane 9 homolog (yeast) Gene
Size: 2ug
Accessions: BC020213
Gene id: 26520
Gene description: translocase of inner mitochondrial membrane 9 homolog (yeast)
Synonyms: TIM9; TIM9A; mitochondrial import inner membrane translocase subunit Tim9; translocase of inner mitochondrial membrane 9 homolog; translocase of inner mitochondrial membrane 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaatgacacaaagaatatccatgagatttcaggaatatcatattcagcagaatgaagccctggcagccaaagcaggactccttggccaaccacgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: