DDOST-dolichyl-diphosphooligosaccharide-protein glycosyltransferase Gene View larger

DDOST-dolichyl-diphosphooligosaccharide-protein glycosyltransferase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDOST-dolichyl-diphosphooligosaccharide-protein glycosyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDOST-dolichyl-diphosphooligosaccharide-protein glycosyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002594
Product type: DNA & cDNA
Ncbi symbol: DDOST
Origin species: Human
Product name: DDOST-dolichyl-diphosphooligosaccharide-protein glycosyltransferase Gene
Size: 2ug
Accessions: BC002594
Gene id: 1650
Gene description: dolichyl-diphosphooligosaccharide-protein glycosyltransferase
Synonyms: AGER1; CDG1R; OKSWcl45; OST; OST48; WBP1; dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit; advanced glycation end-product receptor 1; advanced glycation endproduct receptor 1; dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit (non-catalytic); dolichyl-diphosphooligosaccharide-protein glycotransferase; oligosaccharyl transferase 48 kDa subunit; oligosaccharyltransferase 48 kDa subunit; oligosaccharyltransferase subunit 48; dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtacttccggtgtgcaggtgctgggtccttcggcaggaggaggaagatggagcccagcaccgcggcccgggcttgggccctcttttggttgctgctgcccttgcttggcgcggtttgcgccagcggaccccgcaccttagtgctgctggacaacctcaacgtgcgggagactcattcgcttttcttccggagcctgaaggaccggggctttgagctcacattcaagaccgctgatgaccccagcctgtctctcataaagtatggggaattcctctatgacaatctcatcattttctccccttcggtagaagattttggaggcaacatcaacgtggagaccatcagtgcctttattgacggtggaggcagtgtgctggtagctgccagctccgacattggtgaccctcttcgagagctgggcagtgagtgcgggattgagtttgacgaggagaaaacggctgtcattgaccatcacaactatgacatctcagaccttggccagcatacgctcatcgtggctgacactgagaacctgctgaaggccccaaccatcgttgggaaatcatctctaaatcccatcctctttcgaggtgttgggatggtggccgatcctgataaccctttggtgctggacatcctgacgggctcttccacctcttactccttcttcccggacaagcctatcacccagtatccacatgcggtggggaagaacaccctcctcattgctgggctccaggccaggaacaatgcccgcgtcatcttcagcggctccctcgacttcttcagcgactccttcttcaactcagcagtgcagaaggcggcgcccggctcccagaggtattcccagacaggcaactatgaactagctgtggccctctcccgctgggtgttcaaggaggagggtgtcctccgtgtggggcctgtgtcccatcatcgggtgggtgagacagccccacccaatgcctacactgtcactgacctagtggagtatagcatcgtgatccagcagctctcaaatggcaaatgggtcccctttgatggcgatgacattcagctggagtttgtccgcattgatccttttgtgaggaccttcctgaagaagaaaggtggcaaatacagtgttcagttcaagttgcccgacgtgtatggtgtattccagtttaaagtggattacaaccggctaggctacacacacctgtactcttccactcaggtatccgtgcggccactccagcacacgcagtatgagcgcttcatcccctcggcctacccctactacgccagcgccttctccatgatgctggggctcttcatcttcagcatcgtcttcttgcacatgaaggagaaggagaagtccgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Cas-Br-M (murine) ecotropic retroviral transforming sequence c
- solute carrier organic anion transporter family, member 6A1
- translocase of inner mitochondrial membrane 9 homolog (yeast)
- potassium voltage-gated channel, Isk-related family, member 1

Buy DDOST-dolichyl-diphosphooligosaccharide-protein glycosyltransferase Gene now

Add to cart