NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene View larger

NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001403
Product type: DNA & cDNA
Ncbi symbol: NUDT21
Origin species: Human
Product name: NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene
Size: 2ug
Accessions: BC001403
Gene id: 11051
Gene description: nudix (nucleoside diphosphate linked moiety X)-type motif 21
Synonyms: CFIM25; CPSF5; cleavage and polyadenylation specificity factor subunit 5; CPSF 25 kDa subunit; cleavage and polyadenylation specific factor 5, 25 kD subunit; cleavage and polyadenylation specific factor 5, 25 kDa; cleavage and polyadenylation specificity factor 25 kDa subunit; cleavage factor Im complex 25 kDa subunit; nucleoside diphosphate-linked moiety X motif 21; nudix (nucleoside diphosphate linked moiety X)-type motif 21; nudix motif 21; pre-mRNA cleavage factor Im (25kD); pre-mRNA cleavage factor Im 25 kDa subunit; pre-mRNA cleavage factor Im, 25kD subunit; nudix hydrolase 21
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgtggtaccgcccaatcgctcgcagaccggctggccccggggggtcactcagttcggcaacaagtacatccagcagacgaagcccctcaccctggagcgcaccatcaacctgtaccctcttaccaattatacttttggtacaaaagagcccctctacgagaaggacagctctgttgcagccagatttcagcgcatgagggaagaatttgataaaattggaatgaggaggactgtagaaggggttctgattgtacatgagcaccggctaccccatgtgttactgctgcagctgggaacaactttcttcaaactacctggtggtgaacttaacccaggagaagatgaagttgaaggactaaaacgcttaatgacagagatactgggtcgtcaggatggagttttgcaagactgggtcattgacgattgcattggtaactggtggagaccaaattttgaacctcctcagtatccatatattcctgcacatattacaaagcctaaggaacataagaagttgtttctggttcagcttcaagaaaaagccttgtttgcagtccctaaaaattacaagctggtagctgcaccattgtttgaattgtatgacaatgcaccaggatatggacccatcatttctagtctccctcagctgttgagcaggttcaattttatttacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - potassium voltage-gated channel, Isk-related family, member 3
- protein kinase, AMP-activated, gamma 2 non-catalytic subunit
- dolichyl-diphosphooligosaccharide-protein glycosyltransferase
- Cas-Br-M (murine) ecotropic retroviral transforming sequence c

Buy NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene now

Add to cart