Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene
PTXBC001403
New product
Data sheet of NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001403 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT21 |
| Origin species: | Human |
| Product name: | NUDT21-nudix (nucleoside diphosphate linked moiety X)-type motif 21 Gene |
| Size: | 2ug |
| Accessions: | BC001403 |
| Gene id: | 11051 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 21 |
| Synonyms: | CFIM25; CPSF5; cleavage and polyadenylation specificity factor subunit 5; CPSF 25 kDa subunit; cleavage and polyadenylation specific factor 5, 25 kD subunit; cleavage and polyadenylation specific factor 5, 25 kDa; cleavage and polyadenylation specificity factor 25 kDa subunit; cleavage factor Im complex 25 kDa subunit; nucleoside diphosphate-linked moiety X motif 21; nudix (nucleoside diphosphate linked moiety X)-type motif 21; nudix motif 21; pre-mRNA cleavage factor Im (25kD); pre-mRNA cleavage factor Im 25 kDa subunit; pre-mRNA cleavage factor Im, 25kD subunit; nudix hydrolase 21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgtggtaccgcccaatcgctcgcagaccggctggccccggggggtcactcagttcggcaacaagtacatccagcagacgaagcccctcaccctggagcgcaccatcaacctgtaccctcttaccaattatacttttggtacaaaagagcccctctacgagaaggacagctctgttgcagccagatttcagcgcatgagggaagaatttgataaaattggaatgaggaggactgtagaaggggttctgattgtacatgagcaccggctaccccatgtgttactgctgcagctgggaacaactttcttcaaactacctggtggtgaacttaacccaggagaagatgaagttgaaggactaaaacgcttaatgacagagatactgggtcgtcaggatggagttttgcaagactgggtcattgacgattgcattggtaactggtggagaccaaattttgaacctcctcagtatccatatattcctgcacatattacaaagcctaaggaacataagaagttgtttctggttcagcttcaagaaaaagccttgtttgcagtccctaaaaattacaagctggtagctgcaccattgtttgaattgtatgacaatgcaccaggatatggacccatcatttctagtctccctcagctgttgagcaggttcaattttatttacaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium voltage-gated channel, Isk-related family, member 3 - protein kinase, AMP-activated, gamma 2 non-catalytic subunit - dolichyl-diphosphooligosaccharide-protein glycosyltransferase - Cas-Br-M (murine) ecotropic retroviral transforming sequence c |