D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene View larger

D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene

PTXBC001745

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001745
Product type: DNA & cDNA
Ncbi symbol: D4S234E
Origin species: Human
Product name: D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene
Size: 2ug
Accessions: BC001745
Gene id: 27065
Gene description: DNA segment on chromosome 4 (unique) 234 expressed sequence
Synonyms: D4S234E; D4S234; NEEP21; P21; neuron-specific protein family member 1; brain neuron cytoplasmic protein 1; carboxyterminally EE-tagged neuron-enriched endosomal 21 kDa protein; neuron specific gene family member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaagttggggaacaatttcgcagagaagggcaccaagcagccgctgctggaggatggcttcgacaccattcccctgatgacgcccctcgatgtcaatcagctgcagttcccgcccccggataaggtggtcgtgaaaactaagaccgagtatgaacctgaccgcaagaaagggaaagcacgtcctccccaaattgctgagttcaccgtcagcatcacggagggtgtcaccgagaggtttaaggtctccgtgttggtcctcttcgccctggccttcctcacctgcgtcgtcttcctggttgtctacaaggtgtacaagtatgaccgcgcctgccccgatgggttcgtcctcaagaacacccagtgcatcccagaaggcttggagagctactacgcggagcaagactccagtgcccgggagaaattttacacagtcataaaccactacaacctggccaagcagagcatcacgcgctccgtatcgccctggatgtcagttctgtcagaagagaagctgtccgagcaggagactgaagcggctgagaagtcagcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nudix (nucleoside diphosphate linked moiety X)-type motif 21
- potassium voltage-gated channel, Isk-related family, member 3
- protein kinase, AMP-activated, gamma 2 non-catalytic subunit
- dolichyl-diphosphooligosaccharide-protein glycosyltransferase

Buy D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene now

Add to cart