Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene
PTXBC001745
New product
Data sheet of D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001745 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | D4S234E |
| Origin species: | Human |
| Product name: | D4S234E-DNA segment on chromosome 4 (unique) 234 expressed sequence Gene |
| Size: | 2ug |
| Accessions: | BC001745 |
| Gene id: | 27065 |
| Gene description: | DNA segment on chromosome 4 (unique) 234 expressed sequence |
| Synonyms: | D4S234E; D4S234; NEEP21; P21; neuron-specific protein family member 1; brain neuron cytoplasmic protein 1; carboxyterminally EE-tagged neuron-enriched endosomal 21 kDa protein; neuron specific gene family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaagttggggaacaatttcgcagagaagggcaccaagcagccgctgctggaggatggcttcgacaccattcccctgatgacgcccctcgatgtcaatcagctgcagttcccgcccccggataaggtggtcgtgaaaactaagaccgagtatgaacctgaccgcaagaaagggaaagcacgtcctccccaaattgctgagttcaccgtcagcatcacggagggtgtcaccgagaggtttaaggtctccgtgttggtcctcttcgccctggccttcctcacctgcgtcgtcttcctggttgtctacaaggtgtacaagtatgaccgcgcctgccccgatgggttcgtcctcaagaacacccagtgcatcccagaaggcttggagagctactacgcggagcaagactccagtgcccgggagaaattttacacagtcataaaccactacaacctggccaagcagagcatcacgcgctccgtatcgccctggatgtcagttctgtcagaagagaagctgtccgagcaggagactgaagcggctgagaagtcagcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 21 - potassium voltage-gated channel, Isk-related family, member 3 - protein kinase, AMP-activated, gamma 2 non-catalytic subunit - dolichyl-diphosphooligosaccharide-protein glycosyltransferase |