PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene View larger

PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016183
Product type: DNA & cDNA
Ncbi symbol: PPP2R5C
Origin species: Human
Product name: PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene
Size: 2ug
Accessions: BC016183
Gene id: 5527
Gene description: protein phosphatase 2, regulatory subunit B', gamma isoform
Synonyms: B56G; PR61G; serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform; B' alpha regulatory subunit; PP2A B subunit isoform B'-gamma; PP2A B subunit isoform B56-gamma; PP2A B subunit isoform PR61-gamma; PP2A B subunit isoform R5-gamma; protein phosphatase 2 regulatory subunit B', gamma; protein phosphatase 2, regulatory subunit B (B56), gamma isoform; protein phosphatase 2, regulatory subunit B', gamma isoform; renal carcinoma antigen NY-REN-29; protein phosphatase 2 regulatory subunit B'gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgacatgtaataaagcgggcagcaggatggtggtggatgcggccaactccaatgggcctttccagcccgtggtccttctccatattcgagatgttcctcctgctgatcaagagaagctttttatccagaagttacgtcagtgttgcgtcctctttgactttgtttctgatccactaagtgacctaaagtggaaggaagtaaaacgagctgctttaagtgaaatggtagaatatatcacccataatcggaatgtgatcacagagcctatttacccagaagtagtccatatgtttgcagttaacatgtttcgaacattaccaccttcctccaatcctacgggagcggaatttgacccggaggaagatgaaccaacgttagaagcagcctggcctcatctacagcttgtttatgaatttttcttaagatttttagagtctccagatttccaacctaatatagcgaagaaatatattgatcagaagtttgtattgcagcttttagagctctttgacagtgaagatcctcgggagagagattttcttaaaaccacccttcacagaatctatgggaaattcctaggcttgagagcttacatcagaaaacagataaataatatattttataggtttatttatgaaacagagcatcataatggcatagcagagttactggaaatattgggaagtataattaatggatttgccttaccactaaaagaagagcacaagattttcttattgaaggtgttactacctttgcacaaagtgaaatctctgagtgtctaccatccccagctggcatactgtgtagtgcagtttttagaaaaggacagcaccctcacggaaccagtggtgatggcacttctcaaatactggccaaagactcacagtccaaaagaagtaatgttcttaaacgaattagaagagattttagatgtcattgaaccatcagaatttgtgaagatcatggaacccctcttccggcagttggccaaatgtgtctccagcccacacttccaggtggcagagcgagctctctattactggaataatgaatacatcatgagtttaatcagtgacaacgcagcgaagattctgcccatcatgtttccttccttgtaccgcaactcaaagacccattggaacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Cas-Br-M (murine) ecotropic retroviral transforming sequence b
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa
- DNA segment on chromosome 4 (unique) 234 expressed sequence
- nudix (nucleoside diphosphate linked moiety X)-type motif 21

Buy PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene now

Add to cart