Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene
PTXBC016183
New product
Data sheet of PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016183 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP2R5C |
| Origin species: | Human |
| Product name: | PPP2R5C-protein phosphatase 2, regulatory subunit B', gamma isoform Gene |
| Size: | 2ug |
| Accessions: | BC016183 |
| Gene id: | 5527 |
| Gene description: | protein phosphatase 2, regulatory subunit B', gamma isoform |
| Synonyms: | B56G; PR61G; serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform; B' alpha regulatory subunit; PP2A B subunit isoform B'-gamma; PP2A B subunit isoform B56-gamma; PP2A B subunit isoform PR61-gamma; PP2A B subunit isoform R5-gamma; protein phosphatase 2 regulatory subunit B', gamma; protein phosphatase 2, regulatory subunit B (B56), gamma isoform; protein phosphatase 2, regulatory subunit B', gamma isoform; renal carcinoma antigen NY-REN-29; protein phosphatase 2 regulatory subunit B'gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgacatgtaataaagcgggcagcaggatggtggtggatgcggccaactccaatgggcctttccagcccgtggtccttctccatattcgagatgttcctcctgctgatcaagagaagctttttatccagaagttacgtcagtgttgcgtcctctttgactttgtttctgatccactaagtgacctaaagtggaaggaagtaaaacgagctgctttaagtgaaatggtagaatatatcacccataatcggaatgtgatcacagagcctatttacccagaagtagtccatatgtttgcagttaacatgtttcgaacattaccaccttcctccaatcctacgggagcggaatttgacccggaggaagatgaaccaacgttagaagcagcctggcctcatctacagcttgtttatgaatttttcttaagatttttagagtctccagatttccaacctaatatagcgaagaaatatattgatcagaagtttgtattgcagcttttagagctctttgacagtgaagatcctcgggagagagattttcttaaaaccacccttcacagaatctatgggaaattcctaggcttgagagcttacatcagaaaacagataaataatatattttataggtttatttatgaaacagagcatcataatggcatagcagagttactggaaatattgggaagtataattaatggatttgccttaccactaaaagaagagcacaagattttcttattgaaggtgttactacctttgcacaaagtgaaatctctgagtgtctaccatccccagctggcatactgtgtagtgcagtttttagaaaaggacagcaccctcacggaaccagtggtgatggcacttctcaaatactggccaaagactcacagtccaaaagaagtaatgttcttaaacgaattagaagagattttagatgtcattgaaccatcagaatttgtgaagatcatggaacccctcttccggcagttggccaaatgtgtctccagcccacacttccaggtggcagagcgagctctctattactggaataatgaatacatcatgagtttaatcagtgacaacgcagcgaagattctgcccatcatgtttccttccttgtaccgcaactcaaagacccattggaacaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Cas-Br-M (murine) ecotropic retroviral transforming sequence b - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa - DNA segment on chromosome 4 (unique) 234 expressed sequence - nudix (nucleoside diphosphate linked moiety X)-type motif 21 |