Login to display prices
Login to display prices
FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene View larger

FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008467
Product type: DNA & cDNA
Ncbi symbol: FMC1
Origin species: Human
Product name: FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC008467
Gene id: 154791
Gene description: formation of mitochondrial complexes 1 homolog (S. cerevisiae)
Synonyms: C7orf55; HSPC268; UPF0562 protein C7orf55; formation of mitochondrial complexes 1 homolog; formation of mitochondrial complex V assembly factor 1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccttagggtccccggcgcacacttttcgaggacttctgcgggagttgcgctacctgagcgcggccaccggccgaccctatcgcgacaccgcggcctatcggtaccttgtgaaggctttccgtgcacatcgggtcaccagtgaaaagttgtgcagagcccaacatgagcttcatttccaagctgccacctatctctgcctcctgcgtagcatccggaaacatgtggccctacatcaggaatttcatggcaagggtgagcgctcggtggaggagtctgctggcttggtgggtctcaagttgccccatcagcctggagggaagggctgggagccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
- mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
- potassium voltage-gated channel, Isk-related family, member 4
- protein kinase, AMP-activated, gamma 1 non-catalytic subunit