FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene

View larger

FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene

Reference: PTXBC008467

Condition: New product

Print

Data sheet of FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC008467
Product type:	DNA & cDNA
Ncbi symbol:	FMC1
Origin species:	Human
Product name:	FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene
Size:	2ug
Accessions:	BC008467
Gene id:	154791
Gene description:	formation of mitochondrial complexes 1 homolog (S. cerevisiae)
Synonyms:	C7orf55; HSPC268; UPF0562 protein C7orf55; formation of mitochondrial complexes 1 homolog; formation of mitochondrial complex V assembly factor 1 homolog
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcggccttagggtccccggcgcacacttttcgaggacttctgcgggagttgcgctacctgagcgcggccaccggccgaccctatcgcgacaccgcggcctatcggtaccttgtgaaggctttccgtgcacatcgggtcaccagtgaaaagttgtgcagagcccaacatgagcttcatttccaagctgccacctatctctgcctcctgcgtagcatccggaaacatgtggccctacatcaggaatttcatggcaagggtgagcgctcggtggaggagtctgctggcttggtgggtctcaagttgccccatcagcctggagggaagggctgggagccatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) - potassium voltage-gated channel, Isk-related family, member 4 - protein kinase, AMP-activated, gamma 1 non-catalytic subunit

Reviews

Be the first to write your review !

Buy FMC1-formation of mitochondrial complexes 1 homolog (S. cerevisiae) Gene now