NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene View larger

NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005358
Product type: DNA & cDNA
Ncbi symbol: NHP2L1
Origin species: Human
Product name: NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC005358
Gene id: 4809
Gene description: NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
Synonyms: NHP2L1; 15.5K; FA-1; FA1; NHPX; OTK27; SNRNP15-5; SPAG12; SSFA1; NHP2-like protein 1; NHP2 non-histone chromosome protein 2-like 1; U4/U6.U5 tri-snRNP 15.5 kDa protein; [U4/U6.U5] tri-snRNP 15.5 kD RNA binding protein; high mobility group-like nuclear protein 2 homolog 1; non-histone chromosome protein 2-like 1; sperm specific antigen 1; SNU13 homolog, small nuclear ribonucleoprotein (U4/U6.U5)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgaggctgatgtgaatccaaaggcctacccccttgccgatgcccacctcaccaagaagctactggacctcgttcagcagtcatgtaactataagcagcttcggaaaggagccaatgaggccaccaaaaccctcaacaggggcatctctgagttcatcgtgatggctgcagacgccgagccactggagatcattctgcacctgccgctgctgtgtgaagacaagaatgtgccctacgtgtttgtgcgctccaagcaggccctggggagagcctgtggggtctccaggcctgtcatcgcctgttctgtcaccatcaaagaaggctcgcagctgaaacagcagatccaatccattcagcagtccattgaaaggctcttagtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae)
- potassium voltage-gated channel, Isk-related family, member 4
- protein kinase, AMP-activated, gamma 1 non-catalytic subunit
- protein phosphatase 2, regulatory subunit B', gamma isoform

Buy NHP2L1-NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene now

Add to cart