C5orf46-chromosome 5 open reading frame 46 Gene View larger

C5orf46-chromosome 5 open reading frame 46 Gene

PTXBC021680

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf46-chromosome 5 open reading frame 46 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf46-chromosome 5 open reading frame 46 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021680
Product type: DNA & cDNA
Ncbi symbol: C5orf46
Origin species: Human
Product name: C5orf46-chromosome 5 open reading frame 46 Gene
Size: 2ug
Accessions: BC021680
Gene id: 389336
Gene description: chromosome 5 open reading frame 46
Synonyms: uncharacterized protein C5orf46; SSSP1; CTC-327F10.5; skin and saliva secreted protein 1; chromosome 5 open reading frame 46
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtcttagtacttcgcctgacagttgtcctgggactgcttgtcttattcctgacctgctatgcagacgacaaaccagacaagccagacgacaagccagacgactcgggcaaagacccaaagccagacttccccaaattcctaagcctcctgggcacagagatcattgagaatgcagtcgagttcatcctccgctccatgtccaggagcacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 6 open reading frame 48
- chromosome 1 open reading frame 97
- chromosome 8 open reading frame 40
- allograft inflammatory factor 1-like

Buy C5orf46-chromosome 5 open reading frame 46 Gene now

Add to cart