C5orf13-chromosome 5 open reading frame 13 Gene View larger

C5orf13-chromosome 5 open reading frame 13 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C5orf13-chromosome 5 open reading frame 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C5orf13-chromosome 5 open reading frame 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019068
Product type: DNA & cDNA
Ncbi symbol: C5orf13
Origin species: Human
Product name: C5orf13-chromosome 5 open reading frame 13 Gene
Size: 2ug
Accessions: BC019068
Gene id: 9315
Gene description: chromosome 5 open reading frame 13
Synonyms: C5orf13; D4S114; PRO1873; PTZ17; SEZ17; neuronal regeneration-related protein; neuronal protein 3.1; neuronal regeneration related protein homolog; protein p311; neuronal regeneration related protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtttattacccagaactctttgtctgggtcagtcaagaaccatttccaaacaaggacatggagggaaggcttcctaagggaagacttcctgtcccaaaggaagtgaaccgcaagaagaacgatgagacaaacgctgcctccctgactccactgggcagcagtgaactccgctccccaagaatcagttacctccactttttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 5 open reading frame 46
- chromosome 6 open reading frame 48
- chromosome 1 open reading frame 97
- chromosome 8 open reading frame 40

Buy C5orf13-chromosome 5 open reading frame 13 Gene now

Add to cart