Login to display prices
Login to display prices
PLN-phospholamban Gene View larger

PLN-phospholamban Gene

PTXBC005269

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLN-phospholamban Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLN-phospholamban Gene

Proteogenix catalog: PTXBC005269
Ncbi symbol: PLN
Product name: PLN-phospholamban Gene
Size: 2ug
Accessions: BC005269
Gene id: 5350
Gene description: phospholamban
Synonyms: CMD1P; CMH18; PLB; cardiac phospholamban
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaagtccaatacctcactcgctcagctataagaagagcctcaaccattgaaatgcctcaacaagcacgtcaaaagctacagaatctatttatcaatttctgtctcatcttaatatgtctcttgctgatctgtatcatcgtgatgcttctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: